Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 55SA
Summary Introduction
To review:
Role of polyamines(spermine and spermidine)in enhancing the stability ofDNA(deoxyribonucleic acid)structure and in promoting its supercoiling.
Introduction:
Polyamines, such asspermine and spermidin, ere the polycationic
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What is meant by the description "antiparellel" regarding the two strands that make up DNA?
The polyamines spermine and spermidine have numerous effects on both prokaryotic and eukaryotic cells. Examples include chromatin condensation, transcription, translation, and apoptosis. They are best known for their role in promoting DNA stability. Explain how polyamines enhance DNA stability and promote supercoiling
Cytosine can be deaminated to form Uracil
What type of mutation is this classified as?
Discuss what happens to the base-pairing properties from switching from C to U?
When U is replicated in two rounds of synthesis, what substitution does this result in?
Before Uracil alters the DNA during replication, what repair system can be used to correct this error?
Describe how this type of DNA repair works?
Chapter 17 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Prob. 5QCh. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 1RQCh. 17 - Prob. 2RQ
Ch. 17 - Prob. 3RQCh. 17 - Prob. 4RQCh. 17 - Prob. 5RQCh. 17 - Prob. 6RQCh. 17 - Prob. 7RQCh. 17 - Prob. 8RQCh. 17 - Prob. 9RQCh. 17 - Prob. 10RQCh. 17 - Prob. 11RQCh. 17 - Prob. 12RQCh. 17 - Prob. 13RQCh. 17 - Prob. 14RQCh. 17 - Prob. 15RQCh. 17 - Prob. 16RQCh. 17 - Prob. 17RQCh. 17 - Prob. 18RQCh. 17 - Prob. 19RQCh. 17 - Prob. 20RQCh. 17 - Prob. 21RQCh. 17 - Prob. 22RQCh. 17 - Prob. 23RQCh. 17 - Prob. 24RQCh. 17 - Prob. 25RQCh. 17 - Prob. 26RQCh. 17 - Prob. 27RQCh. 17 - Prob. 28RQCh. 17 - Prob. 29RQCh. 17 - Prob. 30RQCh. 17 - Prob. 31RQCh. 17 - Prob. 32RQCh. 17 - Prob. 33RQCh. 17 - Prob. 34RQCh. 17 - Prob. 35RQCh. 17 - Prob. 36RQCh. 17 - Prob. 37RQCh. 17 - Prob. 38RQCh. 17 - Prob. 39RQCh. 17 - Prob. 40RQCh. 17 - Prob. 41FBCh. 17 - Prob. 42FBCh. 17 - Prob. 43FBCh. 17 - Prob. 44FBCh. 17 - Prob. 45FBCh. 17 - Prob. 46FBCh. 17 - Prob. 47FBCh. 17 - Prob. 48FBCh. 17 - Prob. 49FBCh. 17 - Prob. 50FBCh. 17 - Prob. 51SACh. 17 - Prob. 52SACh. 17 - Prob. 53SACh. 17 - Prob. 54SACh. 17 - Prob. 55SACh. 17 - Prob. 56TQCh. 17 - Prob. 57TQCh. 17 - Prob. 58TQCh. 17 - Prob. 59TQCh. 17 - Prob. 60TQCh. 17 - Prob. 61TQCh. 17 - Prob. 62TQCh. 17 - Prob. 63TQCh. 17 - Prob. 64TQCh. 17 - Prob. 65TQCh. 17 - Prob. 66TQCh. 17 - Prob. 67TQCh. 17 - Prob. 68TQCh. 17 - Prob. 69TQCh. 17 - Prob. 70TQCh. 17 - Prob. 71TQCh. 17 - Prob. 72TQCh. 17 - Prob. 73TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?arrow_forwardIn E. coli, all newly synthesized DNA appears to be fragmented (an observation that could be interpreted to mean that the leading strand as well as the lagging strand is synthesized discontinuously). However, in E. coli mutants that are defective in uracil–DNA glycosylase, only about half the newly synthesized DNA is fragmented. Explain.arrow_forwardCystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?arrow_forward
- What entropic factor destabilizes helical DNA at high temperature?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardEnediynes are natural products with potent antitumor properties because they are able to cleave DNA (page 288). Their cytotoxic properties are due tothe enediyne undergoing a cyclization to form a highly reactive diradical intermediate. The intermediate abstracts hydrogen atoms from the backbone of DNA, which triggers its damage. Draw the structure of the diradical intermediate.arrow_forward
- How does KU proteins promote DNA repair during mitosis? Explain.arrow_forwardThe cancer drug melphalan is an alkylating agent of the mustard gas family. It acts in two ways: by causing alkylation of guanine bases and by cross linking DNA strands together. Describe two ways in which melphalan might kill cancer cells. What are two ways in which cancer cells could repair the DNA-damaging effects of melphalan?arrow_forwardWhat are histone demethylases.?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY