Concept explainers
a.
To determine: The endosperm genotypes result from crosses s/s female x S/S male
Introduction: Corn is generally classed as to kernel endosperm characteristics. Endosperm refers to an edible seed tissue, surrounding and absorbed by the embryo.
b.
To determine: The endosperm genotypes result from crosses S/S female x s/s male.
Introduction: Endosperm is a structure of a seed that stores nutrients. Nutrients are stored in the form of starch, proteins or oils and these nutrients are utilized by the seed during developmentgermination to develop an embryo.
c.
To determine: The endosperm genotypes result from crosses S/s female x S/s male.
Introduction: The genotype is the part of the genetic makeup of a cell, and therefore of any individual, which determines one of its characteristics.
Want to see the full answer?
Check out a sample textbook solutionChapter 2 Solutions
Introduction to Genetic Analysis
- In peas, yellow pods are dominant to green pods. Show the results of a cross between a pure yellow plant and a hybrid yellow plant. RA + v в I Paragrapharrow_forwardDiagram the P1 and F1 crosses, using Mendelian notation, to show the possible genotypes found in each generation. (Remember a diagram is just the cross itself, not the progeny).arrow_forwardIn peas, tall is dominant over dwarf. If a plant homozygous for tall is crossed with one homozygous for dwarf : a. What will be the genotype(s) (use the initial of your last name) and phenotype (s) of the F1 plants? b. If the F1 is grown the next season, predict the possible genotypes and phenotypes. c. If you cross the F1 to the tall parent, what phenotype will result of the cross? What will be the ratio of the genotype? d. If you cross the F1 to the short parent, what phenotype will result of the cross? What will be the ratio of the genotype?arrow_forward
- A cross between two red flower plants produces 2/3 progeny that are red and1/3 progeny that are yellow. What is the genotype of the red flower? Explain these unexpected ratios.arrow_forward. a. A mouse cross A/a ⋅ B/b × a/a ⋅ b/b is made, and inthe progeny there are25% A/a ⋅ B/b, 25% a/a ⋅ b/b,25% A/a ⋅ b/b, 25% a/a ⋅ B/bExplain these proportions with the aid of simplifiedmeiosis diagrams.b. A mouse cross C/c ⋅ D/d × c/c ⋅ d/d is made, and inthe progeny there are45% C/c ⋅ d/d, 45% c/c ⋅ D/d,5% c/c ⋅ d/d, 5% C/c ⋅ D/dExplain these proportions with the aid of simplifiedmeiosis diagrams.arrow_forwardMutations Adenosine triphosphate is an energy molecule found in cells and produced as a result of cellular respiration. Many enzymes are required for cellular respiration to produce an ATP molecule. The following is an original DNA segment from a sequence that codes for the production of an enzyme necessary for the production of ATP in organisms: Original DNA: TACAAGTTTAGTACGTATATGCCAACT A mutation occurred during replication that resulted in the following change in the segment of DNA: Mutated DNA: TACAAGTTTATGTACGTATATGCCAACT 1) Identify (circle the mutation in the mutated sequence) and name the type of mutation that occurred. 2) Evaluate the the significance of this mutation. a. How does this mutation affect the production of ATP? b. How will this mutation affect this organism cellular respiration process?arrow_forward
- Height among red stalk plants is divided into tall, medium and short. From tests, scientists know it is governed by two alleles of the same gene. It is known that tall plants and short plants are homozygous. What is the genotype of the medium plant? Explain your reasoning in one to two sentences. A cross between a medium plant and a tall plant occurs. What would be the genotypes? Show your work/explain your reasoning. Can medium plants be true breeding (i.e. be bred with other medium plants to ALWAYS produce medium plants)? Explain your reasoning. étv MacBook Pro %23 $ & * 3 4 5 7 8. T Y D F H. Jarrow_forwardIn peas, yellow pods are dominant to green pods. Show the results of a cross between a pure yellow plant and a hybrid yellow plant.arrow_forwardshows the results of a dihybrid cross involving seed shape and seed color. a. What proportion of the round and yellow F2 progeny from this cross is homozygous at both loci? b. What proportion of the round and yellow F2 progeny from this cross is homozygous at least at one locus?arrow_forward
- You make a test cross between an F1 plant that is heterozygous for two dominant resistance genes (R1 and R2) and a line that is homozygous recessive at both loci, and inoculate the progeny with a pathogen race that is avirulent on both R1 and R2 (i.e., it carries avirulence genes Avr1 and Avr2).You get 50 susceptible progeny out of 200 test cross progeny. (a) What is the linkage phase for these two genes? (b) What is the recombination distance?arrow_forwardE. W. Lindstrom crossed two corn plants with green seedlings and obtained the following progeny: 3583 green seedlings, 853 virescentwhite seedlings, and 260 yellow seedlings . Q. Explain how color is determined in these seedlings.arrow_forwardIn a species of flowers, blue petals are dominant over purple petals, and a long stem is dominant over a short one. Cross a flower that is heterozygous for both traits with a flower that is homozygous recessive for petal color and homozygous dominant for stem length. Report the genotype and phenotype. *Write your answers in ratio non-reduced form (Example 16:8) Genotype Phenotypearrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning