Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 36P
Summary Introduction
To determine:
The region at which the centromeric DNA is located.
Introduction:
A scientist conducted experiments by using the DNA of yeast centromere. In this experiment, the yeast centromere DNA was cloned in the YRP7 plasmid. The insertion of this DNA into the plasmid makes the plasmid
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker(such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?
A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two
different host species. One of the most common types of shuttle vectors is the yeast shuttle
vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEp), Yeast
Integrating Plasmid (YIp) and Yeast Replicating Plasmid (YRp). Among these three vectors,
YIp has the lowest transformation frequency and copy number per cell. Explain why Ylp is still
popularly used despite its limitations.
It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation.
a) List all the steps from cell pellet preparation to DNA elution.
b) With which feature can the membrane in the column that comes with the commercial kit bind DNA?
c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?
Chapter 12 Solutions
Genetics: From Genes to Genomes
Ch. 12 - For each of the terms in the left column, choose...Ch. 12 - Many proteins other than histones are found...Ch. 12 - What difference exists between the compaction of...Ch. 12 - What is the role of the core histones in...Ch. 12 - a. About how many molecules of histone H2A would...Ch. 12 - The enzyme micrococcal nuclease can cleave...Ch. 12 - a. What letters are used to represent the short...Ch. 12 - About 2000 G bands are visible in a...Ch. 12 - Suppose you performed a fluorescence in situ...Ch. 12 - Which of the following would be suggested by a...
Ch. 12 - For each of the following pairs of chromatin...Ch. 12 - a. Drosophila b. Humans Give examples of...Ch. 12 - One histone modification that is seen consistently...Ch. 12 - Recently, scientists constructed a transgene that...Ch. 12 - Drosophila geneticists have isolated many...Ch. 12 - On the following figures, genes A and B are on the...Ch. 12 - Prob. 17PCh. 12 - The first page of this chapter displays photos of...Ch. 12 - The human genome contains about 3 billion base...Ch. 12 - The mitotic cell divisions in the early embryo of...Ch. 12 - In an experiment published in the journal Cell in...Ch. 12 - a. What DNA sequences are found at the telomeres...Ch. 12 - Prob. 23PCh. 12 - a. In a fluorescent in situ hybridization FISH...Ch. 12 - If you are comparing the two telomeres in each...Ch. 12 - a. What DNA sequences are commonly found at human...Ch. 12 - On the graphs presented in Problem 21, no data is...Ch. 12 - Prob. 29PCh. 12 - Prob. 30PCh. 12 - In the 1920s, Barbara McClintock, later a Nobel...Ch. 12 - Give at least one example of a chromosomal...Ch. 12 - Cornelia de Lange syndrome CdLS is a rare human...Ch. 12 - a. Give at least three examples of types of...Ch. 12 - A number of yeast-derived elements were added to...Ch. 12 - Prob. 36PCh. 12 - The completely synthetic yeast chromosome Syn III...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the genotype presented (genomic plus plasmid genes), which of the following statements Is phenotype? genome: IS P O`z+Y° plasmid: I* Pt otzY+ no production of either B-gal and permease O B-gal and permease induced when lactose is present no B-gal is produced and expression of permease when lactose is present constitutive expression of B-gal and permease constitutive expression of B-gal and no expression of permeasearrow_forwardYou are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). If you use 0.10 ng of the template plasmid (pET21b SynFd), calculate the ratio of the original to the mutated gene after 10 versus 20 cycles.arrow_forwardA cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHIarrow_forward
- Please DESCRIBE, in outline form, the method you will use to select for bacterial cells that have taken up the pL311 plasmid, and to screen those cells for the presence of plasmids that are likely to contain a cloned gene. Be sure to mention the specific media you will use. In addition, please explain the rationale behind this specific selection and screening procedure. (Remember that you have available the following types of media: (i) media containing neither kanamycin nor X-gal, (ii) media containing BOTH kanamycin and X-gal, (iii) media containing tetracycline, and (iv) media containing ampicillin.arrow_forwardExamine the structure of the pBR322 plasmid depicted below. Assume total size of the plasmid is 4,361 bp and the blue numbers indicate locations of restriction sites relative to the O point at the top of the plasmid. What size fragments would be generated by the following restriction digestion reactions? 1. Sall 2. Sal 1 + BamH1 3. Sal 1 + EcoR1 4. Sal I + BamH1 + EcoR1 PstI 3607 3000 4000 amp ori HindIII Edit View Insert Format Tools Table EcoRI EcoRV 4359 0 29 185 pBR322 4361 bp 2295 NdeI tet 2000 BamHI 375 651 SalI 1000 Type a short answer in the space provided below.arrow_forwardBesides PUC vectors, there are still other plasmid vectors in the market such as pBR327 and pZERO®-1. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail. Give two (2) examples of plasmid vectors that can undergo TA cloning. (i) (ii)arrow_forward
- In this western blot, the levels of phosphorylated TBK (PTBK) decrease with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti- TBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-B-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forwardA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?arrow_forward1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions? (b)Does the undigested plasmid show more than a single band when electrophoresed? Why? (c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)arrow_forward
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: Which antibiotic should be added to the mediumto select cells that have incorporated a plasmid?arrow_forwardAfter transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license