Related questions
Concept explainers
Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer.
A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing.
Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance:
> putative antibiotic resistance gene
ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT
ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT
TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG
CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA
CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC
AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC
CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG
AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG
CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG
AGCAAGATGCTACATGCTTTCGATTATGGTAATGAGGACATTTCG
GGCAATGTAGACAGTTTCTGGCTCGACGGTGGTATTCGAATTTCG
GCCACGGAGCAAATCAGCTTTTTAAGAAAGCTGTATCACAATAAG
TTACACGTATCGGAGCGCAGCCAGCGTATTGTCAAACAAGCCATG
CTGACCGAAGCCAATGGCGACTATATTATTCGGGCTAAAACTGGA
TACGATACTAAGATTGGCTGGTGGGTCGGTTGGGTTGAACTTGAT
GATAATGTGTGGTTTTTTGCGATGAATATGGATATGCCCACATCG
GATGGTTTAGGGCTGCGCCAAGCCATCACAAAAGAAGTGCTCAAA
CAGGAAAAAATTATTCCCTAG
This gene begins with a start codon (ATG) and ends in a stop codon (TAG).
1. What is the amino acid sequence of the protein that is encoded by this gene?
2. Using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) (free tool), try to determine the identity of this protein based on its amino acid sequence. What is the full name of the top hit identified using this tool?
3. What are the Identities, Positives, and Gaps values for the alignment between the protein encoded by this gene and the top hit that you identified using a bioinformatic tool? Briefly explain what these values mean, referring specifically to the amino acid sequence of the protein encoded by this resistance gene and the amino acid sequence of the top hit identified in the online database. That is, what are the specific differences between the two amino acid sequences that explain the Identities, Positives, and Gaps values?
Step by stepSolved in 5 steps with 2 images
- You first need to create a plasmid. What are the minimal components necessary to develop this plasmid? In addition to these components, please draw the plasmid. In this illustration, I am looking for the components, the direction of transcription (i.e., the direction the genes will be transcribed), and what should be transcribed last? Also, where would you specifically insert the P. falciparum gene in this plasmid, and why are you checking reading frames in your gene? Finally, please name your plasmid using the correct nomenclature too. You are excited you have this new plasmid; you want to transfect it into P. marinus and provide it as an oral vaccine to laboratory mice. However, even though your supervisor enjoys your enthusiastic attitude, they do not allow you to do this quite yet because all you have is this plasmid. Why doesn’t your supervisor allow you to use the laboratory mouse for this research regarding animal welfare guidelines? Your answer should include the 3 R’s of…arrow_forwardIn this western blot, the levels of actin increase with increasing amounts/expression of the viral protein (VP). Figure description: Increasing amounts of a plasmid expressing the viral protein (0.5, 1, or 2ug) were cotransfected with TBK1 expression plasmid. Cells were harvested 24 h post-transfection and analyzed for phosphorylated TBK1 (anti-PTBK1 Ser172), total TBK1 (anti-TBK1), B-actin (anti-ß-actin), and viral protein (anti-VP) expression by Western blot analysis. VP PTBK1 (S172) TBK1 actin Virus proteins O True O Falsearrow_forwardIf you use the pUC18 vector to clone in the MCS region, predict the following: a) Do bacteria that are blue in color have a cloned insert? b)Do bacteria that are white in color have a cloned insert? c) If you were to grow these cells on Chloramphenicol (an antibiotic), would the bacteria with the pUC plasmid grow? Why or Why not?arrow_forward
- Explain why rolling circle replication of plasmids is semi-conservative.arrow_forwardAssume you have successfully cloned a small (200 bp) fragment of DNA into the polylinker region of a pUC18 cloning vector. Describe the appearance of transformed colonies you would expect to see on each of the following plates: plain media, media containing ampicillin, media containing tetracycline, media containing ampicillin and X-Gal.arrow_forwardBy conducting conjugation experiments between Hfr and recipientstrains, Wollman and Jacob mapped the order of many bacterialgenes. Throughout the course of their studies, they identified severaldifferent Hfr strains in which the F-factor DNA had been integratedat different places along the bacterial chromosome. A sample of theirexperimental results is shown in the following table:What information do you know based on the question and your understanding of the topic?arrow_forward
- To determine if the antibiotic resistance in MH1 was carried on a plasmid, you first isolate the plasmid in MH1 using the plasmid DNA purification technique. Then, you transform bacteria that are not resistant to penicillin/ampicillin with the plasmid isolated from MH1. For the bacterial transformation experiment, you set up the three controls listed below. Match each control with its appropriate purpose (i.e. what it is controlling for) Please note: Transformed bacteria are bacteria that received the plasmid from MH1 and untransformed bacteria are bacteria that did not receive a plasmid. Testing to ensure that the bacteria used in the transformation experiment are viable (i.e. can grow on LB media) (Choose) [ Choose ) after transformation. Untransformed bacteria plated on LB only plate Testing to ensure that the bacteria used in the transformation experiment are viable (ie. can grow on LB media) before transformation. Transformed bacteria plated on LB only plate Untransformed bacteria…arrow_forwardYou are a graduate student working to construct a single gene knockout library of Leptospiria kirschneri, one the causative agents of leptospirosis. You are looking for single gene mutants which disrupt the bacterium’s spirillum shape to determine what role this rare cellular morphology may play in disease development and progression. Using an appropriate donor strain, you introduce the plasmid shown into L. kirschneri. L. kirschneri is not able to replicate the plasmid. The repeat regions are denoted on the plasmid map as vertical black lines, the transposase is denoted as tnp, and kanamycin kinase is denoted as aph. The larger of the two regions is transposed. Following selection and counter-selection, you isolate several non-spirillum colonies, which you use to infect juvenile piglets. Most of the infected piglets develop leptospirosis. Isolating L. kirschneri from these animals reveals that it has regained its spirillum morphology. What is a likely explanation for this reversion of…arrow_forwardA plasmid has been modified such that it carries the gene for beta-galactosidase (lacZ) under the control of the lac promoter. Between the lac promoter and the lacZ gene is an empty multiple cloning site (MSC). This plasmid also carries ampicillin resistance. E. coli are transformed with this plasmid, and grown on nutrient agar containing ampicillin, IPTG, and the lactose analogue Xgal for 18 hours. Following incubation, the plates are examined. What will be the likely colour of the bacteria colonies?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY 
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON