Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 12, Problem 24P
a. | In a fluorescent in situ hybridization (FISH) experiment, what would you see if you used DNA containing multiple copies of 3 AATCCC 5 as a probe? Show your results on the ideogram accompanying Problem 9 |
b. | What DNA sequence would you use as a probe to track one end of one particular chromosome in a FISH experiment? What would your results look like on the same idiogram? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Explain how DNA probes with different fluorescence emissionwavelengths can be used in a single FISH experiment to map thelocations of two or more genes. This method is called chromosomepainting. Explain why this is an appropriate term.
The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro.
Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction.
W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’
X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’
Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’
Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’
Chapter 12 Solutions
Genetics: From Genes to Genomes
Ch. 12 - For each of the terms in the left column, choose...Ch. 12 - Many proteins other than histones are found...Ch. 12 - What difference exists between the compaction of...Ch. 12 - What is the role of the core histones in...Ch. 12 - a. About how many molecules of histone H2A would...Ch. 12 - The enzyme micrococcal nuclease can cleave...Ch. 12 - a. What letters are used to represent the short...Ch. 12 - About 2000 G bands are visible in a...Ch. 12 - Suppose you performed a fluorescence in situ...Ch. 12 - Which of the following would be suggested by a...
Ch. 12 - For each of the following pairs of chromatin...Ch. 12 - a. Drosophila b. Humans Give examples of...Ch. 12 - One histone modification that is seen consistently...Ch. 12 - Recently, scientists constructed a transgene that...Ch. 12 - Drosophila geneticists have isolated many...Ch. 12 - On the following figures, genes A and B are on the...Ch. 12 - Prob. 17PCh. 12 - The first page of this chapter displays photos of...Ch. 12 - The human genome contains about 3 billion base...Ch. 12 - The mitotic cell divisions in the early embryo of...Ch. 12 - In an experiment published in the journal Cell in...Ch. 12 - a. What DNA sequences are found at the telomeres...Ch. 12 - Prob. 23PCh. 12 - a. In a fluorescent in situ hybridization FISH...Ch. 12 - If you are comparing the two telomeres in each...Ch. 12 - a. What DNA sequences are commonly found at human...Ch. 12 - On the graphs presented in Problem 21, no data is...Ch. 12 - Prob. 29PCh. 12 - Prob. 30PCh. 12 - In the 1920s, Barbara McClintock, later a Nobel...Ch. 12 - Give at least one example of a chromosomal...Ch. 12 - Cornelia de Lange syndrome CdLS is a rare human...Ch. 12 - a. Give at least three examples of types of...Ch. 12 - A number of yeast-derived elements were added to...Ch. 12 - Prob. 36PCh. 12 - The completely synthetic yeast chromosome Syn III...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A technique called fluorescence in situ hybridization (FISH) is described. In this method, a labeled piece of DNA is hybridized to a set of chromosomes. Let’s suppose that you cloned a piece of DNA from G. pubescens and used it as a labeled probe for in situ hybridization. What would you expect to happen if this DNA probe were hybridized to the G. speciosa or G. tetrahit chromosomes? Describe the expected results.arrow_forwardAre you a hidden heterozygote? A PCR analysis (part2) Agarose gel electrophoresis and interpretation la: Several factors (including agarose gel concentration, time and current) affect migration of DNA fragments through the agarose gel. Briefly explain how each of these factors affects DNA migration. Agarose gel concentration: Time: Voltage: 1b: Do DNA fragments move towards the positive or negative end of the gel box? Explain your answer. 1c: What is the purpose of the Tris-Acetate-EDTA (TAE) buffer that the agarose gel is prepared with and submerged in for running? What would happen if you used water to prepare and run the gel instead of TAE buffer? 1d: If the student is homozygous for the brown allele, how many bands will they see in the lanes for the blue and brown allele samples? (circle one) Brown sample: 0 Blue sample: 1 2 more than two. 1 2 more than two. le: If the student is homozygous for the blue allele, how many bands will they see in the lanes for the blue and brown allele…arrow_forwardIf it is not possible to have three bands for one STR region when looking at the DNA from one individual, then how many different STR regions were sampled in the gel electrophoresis simulation to end up with the three bands on the gel. Note: there are several possible correct answers to this question.arrow_forward
- Explain why we choose to use 1% agarose gel for Electrophoretic Analysis of DNA via Agarose gel Electrophoresisarrow_forwardA blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?arrow_forwarda. What type of nucleic acid and from what species would the scientist use to begin construction of her genomic DNA library? b. From what tissue would she isolate this nucleic acid? c. What type of reagent would the scientist use to cut the genome into appropriately sized fragments? d. What size nucleic acid fragments would one aim to prepare for the library construction so as to to avoid having to screen an overwhelming number of clones? e. Into what vector would the scientist ligate her genomic DNA fragments? f. What organism would the scientist use to propagate the clones of her genomic DNA library? g. From the information given in the problem determine what probe could be used to screen the scientist's library to find her clone of interest ?arrow_forward
- "10. Recall the Meselson and Weigle experiment that used two strains of bacteriophage with unique genetic marks ("A and B" or "a and b"). The location of these marks at the end of the chromosome and in close proximity to each other was important for them to get a robust experimental result (configuration 1 below). Imagine that these genetic marks were located in the two additional configurations listed below. Draw the distribution of recombinants (Ab and aB) in a CsCl gradient for all three configurations." A w.Heavy 1 a V Light An w Heavy b maã Light a A B N Heavy a W Light 2.arrow_forward(b) Use a drawing to illustrate the principle of DNA gel electrophoresis. +arrow_forwardPlease answer fast Molecular Basis of Recombination. Draw out the double strand break model of recombination, showing the parental and recombinant outcomes using the assignment provided in class. What phenotype would occur in cells with the following mutations: recA, RuvA, RuvB, Rec Barrow_forward
- Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…arrow_forwardYou have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.arrow_forwardWith regard to DNA microarrays, answer the followingquestions:A. What is attached to the slide? Be specific about the numberof spots, the lengths of DNA fragments, and the origin ofthe DNA fragments.B. What is hybridized to the microarray?C. How is hybridization detected?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license