A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12.Question: How can you explain the presence of colonies thatare resistant to both antibiotics? A plasmid that is both ampicillin and tetracyclineresistant is cleaved with Pstl, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstl-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12.BamHIPvullPstl`AmpicillinresistancegeneSallTetracyclineresistancegene

A plasmid is an extrachromosomal small DNA molecule present in a cell and is also physically…

A plasmid that is both ampicillin and tetracycline resistant is cleaved with Pstl, which cleaves within the ampicillin resistance gene. The cut plasmid is ligated with Pstl-digested Drosophila DNA to prepare a genomic library, and the mixture is used to transform E. coli K12. BamHI Pvull Pstl `Ampicillin resistance gene Sall Tetracycline resistance gene

A plasmid that is both ampicillin and tetracycline resistant is cleaved with Pstl, which cleaves within the ampicillin resistance gene. The cut plasmid is ligated with Pstl-digested Drosophila DNA to prepare a genomic library, and the mixture is used to transform E. coli K12. BamHI Pvull Pstl `Ampicillin resistance gene Sall Tetracycline resistance gene

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Similar questions

A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: Which antibiotic should be added to the mediumto select cells that have incorporated a plasmid?
You are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). If you use 0.10 ng of the template plasmid (pET21b SynFd), calculate the ratio of the original to the mutated gene after 10 versus 20 cycles.
After Drosophila DNA has been treated with a restrictionenzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun”technique, every DNA sequence of Drosophila in a librarycan be recovered.a. How would you identify a clone that contains DNAencoding the protein actin, whose amino acid sequenceis known?b. How would you identify a clone encoding a specifictRNA
Alu 1 EcoRI ori pKY Bgl I Tet: Tetracycline resistance gene A. What would be the donor organism to be used in this cloning? B. How would you make sure you only get your gene of interest (EGF) from donor but nothing else? C. How do you put EGF gene into pKY plasmid? What is the best RE to use when inserting the gene into pKY plasmid? What happens if you use the enzyme Bgl I to insert the gene of interest? How does it affect your cloning result? D. How do you make sure you only grow E.coli that have the gene of interest?
Utilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Primers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAA
You are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). Estimate the amount of time needed to run a PCR for the site-directed mutagenesis for25 vs 30 cycles.
Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.
After characterizing the DNA composition of various cats, you identify a protein-coding gene in tigers called stripes and wish to study the structure of the protein product STRIPES. This requires that you purify recombinant ridges from E. coli. First, the stripes gene must be amplified by PCR and then inserted into an appropriate plasmid for bacterial expression. Such a plasmid is diagrammed below. ori CAP Binding Site من Promoter MCS The restriction sites for Aatll and Kpnl are: Aatll 5'-GACGTC-3' Kpnl = 5'-GGTACC-3' Laco (Operator) -Kpnl Aatll The coding strand for the stripes gene is shown below, with start and stop codons in bold. 5'-ATGCAACAGTAGCTGAAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATGAGGCTCATCTTTGCAGGCAAGCAGCTG GAAGATGGCCGTACTCTTTCTGACTATGCGTCTGAGAGGTGGTATGCAGATCTTCGTGAAGACCCTGACCGGCAAGACCAATGT GAAGGCCAAGATCCAGGATAAAGAAGGCATCCCTCCCGACCAGCAGAGGGCACTCTTTCTGACTACAACATCCAGAAGGAGTCG ACCCTGCACCTGGTCCTGCTGACCGGCAAGACCATCACTCTGGAGGTGGAGCCCAGTGACACCATCGAAAATCCCGACCAGCAG…
After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.
A plasmid contains genes for ampicillin resistance and chloramphenicol resistance and has single sites for Hind III and Eco RI. When genes are inserted into the Eco RI site, transformants are resistant only to ampicillin. In which region is the site for EcoRI located? Group of answer choices within the chloramphenicol gene between the ampicillin and chloramphenicol genes can't be determined within the ampicillin gene