Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 15P
Charles Yanofsky isolated many different trpA- mutants (Fig. 8.3).
| a. | Explain how he could identify Trp- auxotrophs of E. coli using replica plating (recall Fig. 7.6). |
| b. | Assuming that the role of TrpA enzyme in the tryptophan biosynthesis pathway was known, explain how Yanofsky could have identified trpA- mutants among his trp- auxotrophs. (Hint: Recall Beadle and Tatum’s one gene, one enzyme experiments in Chapter 7.) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the purpose of Southern's blotting technique? Explain in detail the biochemical principle that underpin each step of the method.
A classic way to isolate thymidylate synthase-negative mutants of bacteria
is to treat a growing culture with thymidine and trimethoprim. Most of
the cells are killed, and the survivors are greatly enriched in thymidylate
synthase-negative mutants.
(a) What phenotype would allow you to identify these mutants?
(b) What is the biochemical rationale for the selection? (That is, why are the
mutants not killed under these conditions?)
(c) How would the procedure need to be modified to select mammalian cell
mutants defective in thymidylate synthase?
A classic way to isolate thymidylate synthase–negative mutants of bacteriais to treat a growing culture with thymidine and trimethoprim. Most ofthe cells are killed, and the survivors are greatly enriched in thymidylatesynthase–negative mutants.(a) What phenotype would allow you to identify these mutants?(b) What is the biochemical rationale for the selection? (That is, why are themutants not killed under these conditions?)(c) How would the procedure need to be modified to select mammalian cellmutants defective in thymidylate synthase?
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- . Mutants of Neurospora crassa that lack carbamoyl phosphate syn- thetase I (CPS I) require arginine in the medium in order to grow, whereas mutants that lack carbamoyl-phosphate synthetase II (CPS II) require a pyrimidine, such as uracil. A priori, one would expect the active CPS II in the arginine mutants to provide sufficient carbamoyl phosphate for arginine synthesis, and the active CPS I in the pyrimidine mutants to "feed" the pyrimidine pathway. Explain these observations.arrow_forwardFor E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.arrow_forwardMutants of Neurospora crassa that lack carbamoyl phosphate synthetase I (CPS I) require arginine in the medium in order to grow, whereas mutants that lack carbamoyl-phosphate synthetase II (CPS II) require a pyrimidine, such as uracil. A priori, one would expect the active CPS II in the arginine mutants to provide sufficient carbamoyl phosphate for arginine synthesis, and the active CPS I in the pyrimidine mutants to "feed" the pyrimidine pathway. Explain these observations.arrow_forward
- Describe what each of the 12 bands on your Western blot should have been. Remember, the 12 bands will be 4 conditions x 3 proteins (phospho-S6, phospho-AMPK, tubulin). Please describe the relative density of each band compared to the control (for example, how dense will phospho-S6 be in each of the three experimental conditions compared to the control condition?). For each band, provide a well-reasoned rationale for your anticipated result. Give the reason why cell signaling would produce each result in each condition.arrow_forwardA bloactlve hexapeptide was cleaved by trypsln from a larger proteln. The peptlde was sequenced by treatment with varlOus reagents and enzymes. The results are as follows: a) Treatment with cyan0gen bromlde gave a tetrapeptlde of compositlon asp, trp, cys and met. b) Treatment with chymotrypsln gave a tripeptlde of compositlon asp, trp and cys, a dipeptlde wlth the same C-term and an amlno acld. c) Treatment with streptococcal protease gave a dipeptlde and a tetrapeptlde. The composltion of the peptlde Is lys, trp, asp, cys and met 1. What Is the sequence of the hexapeptlde? 2. What is the pl of thls peptlde?arrow_forwardMutation analysis of GCK gene in patients with diabetes revealed a c.114 T→A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) Which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) Draw the expected agarose gel result of a homozygous wild type, homozygous mutant and heterozygote individual after restriction enzyme analysis. ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTGCTGAGGCC ACTCCTGGTCACCATGACAACCACAGGCCCTCTCAGTATCACAGTAAGCCCTGGCAGGAGAATCCCCCACTCCAC ACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Restriction enzyme Recognition seguence www wwwtw ww Nar I GG/CGCC…arrow_forward
- In a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%arrow_forwardFor the lac genotypes of Escherichia coli shown in the following Table 1, predict the expression of beta-galactosidase (Z) and permease (Y) is inducible or noninducible or constitutive. Explain your answer. Table 1 Genotype I-P+O+Z+Y+ (i) (ii) I+P+OCZ+Y+ (iii) ISP+O+Z+Y+ (iv) I+P+O+Z+Y-//I+P-O+Z+Y+ (v) ISP+OcZ+Y+//I-P+O+Z+Y- Condition No lactose No lactose lactose lactose No lactosearrow_forwardThe authors state: "Properties of the single mutants K557R, D591V and K617A, a double mutant, D591V/K617A, and a triple mutant, K557R/D591V/K617A, were evaluated to find an allosteric binding site for citrate." The numbers between the letters represent the residue number altered. The letter in front was the wild type and the letter afterwards is the mutant. How would the the triple mutations K557R and D591V and K617A alter the overall protein? O lower the # of charges, increase the pl O increase the # of charges, increase the pl O lower the # of charges, lower the pl O lower the # of charges, increase the pl O no change in the # of charges, increase the pl O no change in the # of charges, lower the plarrow_forward
- Mutation analysis of GCK gene in patients with diabetes revealed a c.114 T->A (shown in bold and underlined) substitution in heterozygote state. In order to check the mutation in healthy individuals, restriction enzyme analysis will be used. a) which enzyme can we use to differentiate wild type and mutant sequence? Please indicate which allele (wild type or mutant allele) will be cut with the restriction enzyme. Use table 1 shown below. b) ATGAGGCTCTTTGCCACCAGTCCCAGTTTTATGCATGGCAGCTCTAATGACAGGATGGTCACCCCTG СTGAGGCCACTCCTGGTCACCATGACAАССАCAGGCCCTCTТСAGTATCACAGTAAGCCCTGGCAGG AGAATCCCCCACTCCACACCTGGCTGGAGCACGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAG CAGGCTAGGATGTGA Figure 1. GCK gene sequence. Length of the fragment is 213bp. Table1. The restriction enzymes and their recognition sequences. Bestriction enzyme Recognition sequence Nari GG/CGCC Ddel C/TOAG Hae II DGCGC/n Hpal cc/GG Alul AG/CT Smal ccc/GGG Mbol /GATC Mae II IGTDAC Bsp 1286 I GNGCn/c Hind II A/AGCTT ECOR I G/AATTC D: any Ducleotide 1:…arrow_forwardAnalysis of a 49kDA protein is aimed with a western blot technique. For this purpose, "whole cell extract" was obtained from biopsy samples taken from three different individuals, and when their spectrophotometric measurements were made, their concentrations were determined to be 40 µg/µL, 50 µg/µL, and 100 µg/µL for three samples, respectively. At the beginning of the experiment, 200 µg of protein is loaded into each gel well by using a ready 5x loading solution containing SDS and β-mercapta-ethanol together with glycerol and methylene blue dye. a) If loading will be done in a volume of 20µL, then how is the preparation of the samples before loading?b) Considering the loading content given above, what can be said about whether this PAGE is "non-denaturing" or "denaturing". Justify taking into account the loading solution content.arrow_forwardUsing the quarternary structure of hemoglobin shown inFigure 9-3(d), explain in structural terms how a mutation in the β subunit protein could be suppressed by amutation in the a subunit gene.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY