Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 37P
In prokaryotes, a search for genes in a DNA sequence involves scanning the DNA sequence for long open reading frames (that is, reading frames uninterrupted by stop codons). What problem can you see with this approach in eukaryotes?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.
a) Replicate this sense strand to create a double-stranded DNA helix
TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT
b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon.
c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below
5’ UTR:
3’ UTR:
The following DNA sequences found on the sense strand belong to the same eukaryotic gene:
Sequence 1: 5'-GATTCAATAAAGCTCAGATCGCTCACGTCGCGACTC-3'
Sequence 2: 5'-TCCGAGGTCACTAGATACTCGTCGATCGTATAAATG-3'
a) Which sequence is likely to be found upstream from the coding sequence? Justify
your answer.
b) Which sequence is likely to be found downstream from the coding sequence?
Justify your answer.
c) Which sequence will not be transcribed into an mRNA transcript? Justify your
answer.
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. How many different probes must be synthesized to be certain that you will find the cDNA sequence that specifies the protein?arrow_forwardShown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forwardConsidering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?arrow_forward
- There are four codons that encode threonine. Consider the leader sequence in Figure 31.22A. What codons are used and with what frequency?arrow_forwardA protein has the following amino acid sequence: Met-Tyr-Asn-Val-Arg-Val-Tyr-Lys-Ala-Lys-Trp-Leu-Ile-His-Thr-Pro You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probes should be at least 18 nucleotides in length. Q. Which amino acids in the protein should be used to construct the probes so that the least degeneracy results?arrow_forwardAs described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base sequence of a coding region changes by any number of bases other than three base pairs, or multiples of 3, a frameshift mutation occurs. Depending on the location of the sequence change, such mutations can have serious effects. The following synthetic mRNA sequence codes for the beginning of a polypeptide: 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCUUAUC-AUGUUU-3′ First, determine the amino acid sequence of the polypeptide. Then determine the types of mutation that have occurred in the following altered mRNA segments. What effect do these mutations have on the polypeptide products? a. 5′-AUGUCUCCUACUUGCUGACGAGGGAAGGAGGUGGCUUAUCA-UGUUU-3′ b. 5′-AUGUCUCCUACUGCUGACGAGGGAGGAGGUGGCUUAUCAU-GUUU-3′ c. 5′-AUGUCUCCUACUGCUGACGAGGGAAGGAGGUGGCCCUUAUC-AUGUUU-3′ d. 5′-AUGUCUCCUACUGCUGACGGAAGGAGGUGGCUUAUCAU-GUUU-3′arrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.arrow_forward
- Consider the following original coding sequence of a gene that codes for a short 5- amino acid polypeptide: 5'-ATGGGCTCGAACTCATAA-3' Using the genetic code and the amino acid table below, which of the following sequences arises from a non-conservative missense mutation in the original sequence shown above? First base in codon U U A UUU UUC- UUA UUG- CUU CUC CUA CUG- U Phe (F) Leu (L) Leu (L) Second base in codon Val (V) UCU - UCC UCA UCG CCU CCC CCA CCG AUU ACU- AUC Ile (1) ACC AUA- ACA AUG Met (M) start ACG GUU GCU- GUC GCC GUA GCA GUG GCG- C Ser (S) Pro (P) Thr (T) Ala (A) UAU UAC UAAT UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG A Tyr (Y) STOP His (H) Gln (Q) Asn (N) Lys (K) Asp (D) Glu (E) G UGU UGC UGA STOP UGG Trp (W) Cys (C) CGU CGC CGA CGG AGU AGC AGA 1 AGG GGU- GGC GGA GGG Arg (R) Ser (S) Arg (R) Gly (G) U C A G U C A G U C A G U C A G Last base in codonarrow_forwardWhere and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence reads? Select all that apply. Near the end of a read (which is typically about 500-700 bp in length); DNA polymerase will nearly always incorporate a ddNTP into a read when it reaches this length. Anywhere a mutation leads to incorporation of a translation stop codon in the DNA; DNA polymerase is unable to incorporate ddNTPs into this sequence Anywhere the candidate differs from the reference sequence; any deviation from the reference sequence will inhibit the ability of the sequence analyzer to correctly interpret the base In the first 25-100 base pairs of the read; ddNTPs are unlikely to be incorporated in this region because they are greatly outnumbered by dNTPs.arrow_forwardHelp me pleasearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License