Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 32P
The yeast gene encoding a protein found in the mitotic spindle was cloned by a laboratory studying mitosis. The gene encodes a protein of 477 amino acids.
| a. | What is the minimum length in |
| b. | A partial sequence of one DNA strand in an exon containing the middle of the coding region of the yeast gene is given here. What is the sequence of nucleotides of the mRNA in this region of the gene? Show the 5′and 3′ directionality of your strand. 5′ GTAAGTTAACTTTCGACTAGTCCAGGGT 3′ |
| c. | What is the sequence of amino acids in this part of the yeast mitotic spindle protein? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide that this gene produces in liver cells is 46,771 amino acids long. Your colleague studies the function of this gene in brain cells, and finds the polypeptide produced in the brain is much larger – 61,438 amino acids long. How do you explain this difference?
Possible Answers:
A. The cell cycle of liver cells is much longer than that of brain cells.
B. This is due to alternative splicing. in the brain
C. There was a different complement of sequence-specific transcription factor binding sites in the CRM of the brain cells.
D. There is no 5' cap added to the gene product from the liver cells.
A human gene was initially identified as having three exons and two introns. The exons are 456, 224, and 524 bp, whereas the introns are 2.3 kb and 4.6 kb.a. Draw this gene, showing the promoter, introns, exons, and transcription start and stop sites.b. Surprisingly, this gene is found to encode not one but two mRNAs that have only 224 nucleotides in common. The original mRNA is 1204 nucleotides, and the new mRNA is 2524 nucleotides. Use your drawing
After Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardThe coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the genetic code, what is the polypeptide chain sequence when Gene G is completely expressed?arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forward
- Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardDuchenne muscular dystrophy is caused by a mutation in a gene that comprises 2.5 million base pairs and specifies a protein called dystrophin. However, less than 1% of the gene actually encodes the amino acids in the dystrophin protein. On the basis of what you now know about gene structure and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene.arrow_forwardDNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. How many introns and exons are there in this gene? Explain your answer.arrow_forward
- To identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forwardA eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bp long and the second, farthest from the promoter, is 236. The three exons, in sequence from closest to farthest from the promoter, are 213 bp, 180 bp and 423 bp respectively. Draw the structure you would obtain if you hybridized the template strand of the transcribed region of this gene and three hundred base pairs of additional flanking DNA at each end with the mRNA produced from this gene. Can you estimate the size in amino acid residues of the protein coded for by this gene? Please justify you answer.arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forward
- Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?arrow_forwardA eukaryotic protein-encoding gene contains two introns and three exons: exon 1–intron 1–exon 2–intron 2–exon 3. The 5′ splice site at the boundary between exon 2 and intron 2 has been eliminated by a small deletion in the gene. Describe how the pre-mRNA encoded by this mutant gene will be spliced. Indicate which introns and exons will be found in the mRNA after splicing occurs.arrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold). a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the final page)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY