Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 30P
Remembering that the wobble base of the tRNA is the 5′ base of the anticodon:
a. | In human tRNAs, what are the sequences of all possible anticodons that were originally transcribed with A in the wobble position? (Assume this A is always modified to I.) |
b. | In human tRNAs, what are the sequences of all possible anticodons that were originally transcribed with U in the wobble position? (Note: Any single type of tRNA with a U at the wobble position can be modified only in a single way.) |
c. | How might the wobble Us in each of the anticodons in (b) be modified and still be consistent with the genetic code? |
d. | What is the theoretical minimal number of different tRNA genes that must exist in the human genome? (Assume that xo5 U pairs with A, G, or U only.) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
For the anticodon sequences 5' IAA and 5' xm^3s^2UAA, considering the DNA sequences of the genes encoding the tRNAs(assuming both tRNAs exist even if that is not true), What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? be sure to indicate polarities.
What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.
a.
Class I synthetases acylate the terminal 2’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 3’ hydroxyl group of tRNAs.
b.
Class I synthetases acylate the terminal 3’ hydroxyl group of tRNAs; Class II synthetases acylate the terminal 2’ hydroxyl group of tRNAs.
c.
Class I synthetases acylate tRNAs with hydrophobic amino acids; Class II synthetases acylate tRNAs with polar amino acids.
d.
Class I synthetases acylate tRNAs with polar amino acids; Class II synthetases acylate tRNAs with hydrophobic amino acids.
5'....TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAA actgt... 3'
a). (10 points). In the above sequences, the open reading frame is indicated by alternating
non-underlined and underlined triplets. Please use the codon table to deduce the amino
acid sequence for the region shown in the wildtype protein.
Wildtype AA sequence for the region around mutation #1:
Wildtype AA sequence for the region around mutation #2:
b). (10 points). Please make predictions what molecular change mutation #1 and mutation
#2 cause.
c). (5 points). Which mutation is more likely to abrogate the protein function? Why?
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the cytosol. (a) What tRNA structural features is Xpot likely to recognize? (b) How does Xpot distinguish mature tRNAs from pre-tRNAs?arrow_forwardOrnithine is structurally similar to lysine except ornithine’s side chain is one methylene group shorter than that of lysine. Attempts to chemically synthesize and isolate ornithinyl-tRNA proved unsuccessful. Propose a mechanistic explanation. (Hint: Six-membered rings are more stable than sevenmembered rings.)arrow_forwardFor the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.arrow_forward
- In HbS, the human hemoglobin found in individuals with sickle-cell anemia, glutamic acid at position 6 in the beta chain is replaced by valine. Q.) Show that one of the glutamic acid codons can be converted to a valine codon by a single substitution mutation (i.e., by changing one letter in one codon).arrow_forwardDNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules are required for translation of proteins within mitochondria. Explain.arrow_forward28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it carry? b. Answer the same question for the anticodon sequence 5' xm³s²UAA. 29. For parts (a) and (b) of Problem 28, consider the DNA sequences of the genes encoding the tRNAs. (Assume both tRNAs exist even if that is not true.) What is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? What is the sequence of the template strand of each gene for these same three nucleotides? Be sure to indicate polarities.arrow_forward
- The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the A-site RNA, but the rate may vary with the identities of those groups. Propose an explanation why the ribosome synthesizes poly-Pro sequences extremely slowly compared to other peptide sequences.arrow_forwardA double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.arrow_forwardTreating a solution of ribonuclease with 2-mercaptoethanol and urea denatures the enzyme. If the 2-mercaptoethanol is removed, followed by the removal of urea, the ability of the enzyme solution to hydrolyse RNA is reduced by about 99%. What is the most plausible explanation for this observation? a. All of the RNase molecules have about 1% of their usual activity, due to changes to the organisation of disulphide bonds b. Random formation of disulphide bonds mean about 1% of the RNase molecules are 100% active whereas 99% have no activity c. Deprotonation of histidine in the active site of the enzyme means that only about 1% of the enzyme molecules are active d. Deprotonation of histidine in the active site of the enzyme means that all of the enzyme molecules have 1% of their usual activityarrow_forward
- From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′arrow_forwardShown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY