Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 29, Problem 4EQ
A researcher sequenced a portion of a bacterial gene and obtained the following sequence, beginning with the start codon, which is underlined:
ATG CCG GAT TAC CCG GTC CCA AAC AAA ATG ATC GGC CGC CGA ATC TAT CCC
The bacterial strain that contained this gene has been maintained in the laboratory and grown serially for many generations. Recently, another person working in the laboratory isolated DNA from the bacterial strain and sequenced the same region. The following results were obtained:
ATG CCG GAT TAT CCG GTC CCA AAT AAA ATG ATC GGC CGC CGA ATC TAC CCC
Explain why the differences in the sequences may have occurred.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate.
Group A
5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’
3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’
Group B
5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’
3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’
Group C
5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’
3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’
Group D
5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’
3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’
Group E
5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’
3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate.
FIND THE POSSIBLE MUTATIONS
Group D
5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’
3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’
Group E
5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’
3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
Draw a diagram illustrating a bacterial CRISPR locus. Label your drawing with a brief description of each component within the locus.
Chapter 29 Solutions
Genetics: Analysis and Principles
Ch. 29.1 - Prob. 1COMQCh. 29.1 - Prob. 2COMQCh. 29.1 - 3. A pair of birds flies to a deserted island and...Ch. 29.1 - Prob. 4COMQCh. 29.2 - 1. Phylogenetic trees are based on
a. natural...Ch. 29.2 - Prob. 2COMQCh. 29.2 - An approach that is used to construct a...Ch. 29.2 - 4. Horizontal gene transfer is a process in which...Ch. 29.3 - Prob. 1COMQCh. 29.3 - Prob. 2COMQ
Ch. 29.3 - When the chromosomes of closely related species...Ch. 29 - 1. Discuss the two principles on which evolution...Ch. 29 - 2. Evolution, which involves genetic changes in a...Ch. 29 - Prob. 3CONQCh. 29 - Prob. 4CONQCh. 29 - 5. Would each of the following examples of...Ch. 29 - Distinguish between anagenesis and cladogenesis....Ch. 29 - 7. Describe three or more genetic mechanisms that...Ch. 29 - Explain the type of speciation (allopatric,...Ch. 29 - Prob. 9CONQCh. 29 - Prob. 10CONQCh. 29 - Discuss the major differences among allopatric,...Ch. 29 - Prob. 12CONQCh. 29 - Prob. 13CONQCh. 29 - Would the rate of deleterious or beneficial...Ch. 29 - 15. Which would you expect to exhibit a faster...Ch. 29 - Prob. 16CONQCh. 29 - 17. Plant seeds contain storage proteins that are...Ch. 29 - Take a look at the -globin and -globin amino acid...Ch. 29 - Compare and contrast the neutral theory of...Ch. 29 - Prob. 20CONQCh. 29 - 21. As discussed in Chapter 27, genetic variation...Ch. 29 - Prob. 22CONQCh. 29 - Two populations of snakes are separated by a...Ch. 29 - 2. Sympatric speciation by allotetraploidy has...Ch. 29 - 3. Two diploid species of closely related frogs,...Ch. 29 - A researcher sequenced a portion of a bacterial...Ch. 29 - F1hybrids between two species of cotton,Gossypium...Ch. 29 - 6. A species of antelope has 20 chromosomes per...Ch. 29 - Prob. 7EQCh. 29 - 8. Prehistoric specimens often contain minute...Ch. 29 - From the results of the experiment of Figure...Ch. 29 - InChapter 23, a technique called fluorescence in...Ch. 29 - Prob. 11EQCh. 29 - 12. Discuss how the principle of parsimony can be...Ch. 29 - 13. A homologous DNA region, which was 20,000 bp...Ch. 29 - Prob. 14EQCh. 29 - Prob. 1QSDCCh. 29 - 2. Compare the forms of speciation that are slow...Ch. 29 - 3. Do you think that Darwin would object to the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If a researcher wants to use bacteria to make a eukaryotic protein, she should use a plasmid from: Group of answer choices: bacterial cells eukaryotic cells a cDNA library a genomic DNA libraryarrow_forwardWhich of the following sequences, in the double-stranded form, can probably be recognized by a restriction enzyme? Choose an answer from below? TTCCTT CGACGA GTCGAC GGTTGG GAGGACarrow_forwardYou culture bacteria from the soil at a toxic waste dump on an agar plate and pick a single bacterium from which you prepare DNA. The isolated organism is a new, previously uncharacterized species. You perform PCR amplification of this DNA using primers to amplify a short segment of ribosomal DNA. When you use BLAST to find similar sequences, you find the following results. Organism E. coli Streptococcus Burkhoderia Microbacterium oxydans DNA sequence identity. % sequence E-value coverage e-10 E. coli 84% 88% 98% 100% 40% 40% 40% 80% e-12 e-15 e-30 Based on the data in the table, which species is most closely related to your toxic waste dump sample? Microbacterium oxydans Streptococcus Burkhoderiaarrow_forward
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardgiven the following DNA template, write out the cDNA, mRNA, tRNA anticodons, and give the amino acid sequence. what are the three possible outcomes if there ws a base substitution mutation were to occur to the template? template TAC CGC TCC GCC GTC GAC AAT ACC ACTarrow_forwardWhen half of the DNA in the sample is double-stranded, that point is termed the half- reaction time (C0t1/2). Plot a graph below that describes how genome sizes of MS2, T4 and E.coli affects the half-reaction time.arrow_forward
- Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze gene from the bacteria for further analysis. After cloning, he isolated the plasmid carrying his gene of interest for sequencing. Ihsan finally received the nucleotide sequence of his gene. Explain in detail how he could verify whether the nucleotide sequence matches his gene of interest using the bioinformatics databases available.arrow_forwardA linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5′–TAGTTAAAAC–3′ Fragment 2: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 3: 5′–CCCTAGTTAAAAC–3′ Fragment 4: 5′–ACCGCAATACCCTAGTT–3′ Fragment 5: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 6: 5′–ATTTACCGCAAT–3′ On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.arrow_forwardWhen using bacteria to produce a particular protein, why is it usually better to use the cDNA version of the gene rather than the genomic DNA version?arrow_forward
- The following DNA sequence is from a bacteriophage that infects a pathogenic bacterium and scientists want to know if this bacteriophage could prove to be a potential treatment against it. But first scientists need to discover if different strains of this pathogen have restriction endonucleases that it may use for its own protection. They try 3 different RE’s:a) EcoR1 b) HaeIII c) BamH1 Look up the recognition sequences for the 3 Res. Enzymes above and check whether the phage genome (a snippet of which is shown below) will or will not be ‘cut’. Tell me how their experiment worked out and what their conclusion was.G A A A A G G C C A C A A G G C C G T C G A C T T T T A A A A G G C C A C A T G C G G C T T T T C C G G T G T T C C G G C AG C T GA A A AT T T T C C G G T G T A C G CCarrow_forwardHershey and Chase used radioactive components to tag protein and DNA before infecting bacteriophage. What was the most important concept demonstrated by Hershey-Chase experiments? Explain the experiment in detail.arrow_forwardYou are performing an experiment using CRISPR-cas9 to genetically modify the LacZ gene of a culture of E. coli. After you run the experiment, you decide to use gel electrophoresis to genotype the different bacterial cultures to determine if the gene editing was successful. How could your electrophoresis results confirm that the PCR was successful? And how could your electrophoresis results confirm that you successfully extracted genomic DNA from your bacterial samples?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license