A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5′–TAGTTAAAAC–3′ Fragment 2: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 3: 5′–CCCTAGTTAAAAC–3′ Fragment 4: 5′–ACCGCAATACCCTAGTT–3′ Fragment 5: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 6: 5′–ATTTACCGCAAT–3′ On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

In the boxes below, complete the Original DNA, DNA Copy and/or RNA

A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed orange lines. a) Which Okazaki fragment was made first, A, B, or C? b) When ligase joins fragments A and B, will it act at arrow 1, 2, or both?

The type of DNA replication error illustrated in the diagram below is _______________________.

Suppose you have subjected the two given samples of EcoRl digested DNA to get electrophoresis. Draw a diagram of the expected gel to show the location of the cut DNA pieces. 

How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How many fragments and how big each fragment should be after digesting the plasmid with PvuI? How many fragments and how big each fragment should be after digesting with both enzymes? Show your calculation/explanation.

The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’   a. 5’ – CGAUACGC – 3’   b. 5’ – CGATACGC – 3’   c. 5’ – CGAGCUGC – 3’   d. 5’ – CGAGCTGC – 3’   e. None of the above

Use the gel to answer the following questions. You will be constructing a map of the plasmid, pDiddy.   What is the smallest fragment size that the NcoI/EcoRI double digest produces?

The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.

given the following DNA template, write out the cDNA, mRNA, tRNA anticodons, and give the amino acid sequence. what are the three possible outcomes if there ws a base substitution mutation were to occur to the template? template TAC CGC TCC GCC GTC GAC AAT ACC ACT