Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 29, Problem 13EQ
A homologous DNA region, which was 20,000 bp in length, was sequenced from four different species. The following numbers of
| Species A | Species B | Species C | Species D | |
| Species A | 0 | 443 | 719 | 465 |
| Species B | 443 | 0 | 744 | 423 |
| Species C | 719 | 744 | 0 | 723 |
| Species D | 465 | 423 | 723 | 0 |
Construct a phylogenetic tree that describes the evolutionary relationships among these four species using the UPGMA method. Your tree should include values that show the percentages of nucleotide substitutions.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Molecular marker is used to determine relatedness of species which may directly or indirectly exerts an effect on diversity. A hypothetical ancestor has the following DNA sequences: G A A G C T A T T C A T T. There are two lineage with DNA sequences of G A A G G T A T T C T C G, and G A A C C T A T T C T G C.
(1) Determine the percentage of A and T in the DNA sequence of the hypothetical ancestor.
(2) Calculate the percentage of each nitrogenous base in the second lineage.
From the DNA sequence data for the eight species (A through H) shown below, what is the genetic
distance between Species A and Species C?
O 4
5
6
1
O 7
2
3
4
Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT
Species B
ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT
Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT
Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT
Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT
E
Species
Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT
G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT
Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT
5
6
7
The genome relatedness of different organisms can be shown with a phylogenetic tree constructed based on DNA sequence.
(1) Why DNA sequences could be used to deduce genome relationship?
(2) What else may be used to suggest the relatedness of different genomes?
Chapter 29 Solutions
Genetics: Analysis and Principles
Ch. 29.1 - Prob. 1COMQCh. 29.1 - Prob. 2COMQCh. 29.1 - 3. A pair of birds flies to a deserted island and...Ch. 29.1 - Prob. 4COMQCh. 29.2 - 1. Phylogenetic trees are based on
a. natural...Ch. 29.2 - Prob. 2COMQCh. 29.2 - An approach that is used to construct a...Ch. 29.2 - 4. Horizontal gene transfer is a process in which...Ch. 29.3 - Prob. 1COMQCh. 29.3 - Prob. 2COMQ
Ch. 29.3 - When the chromosomes of closely related species...Ch. 29 - 1. Discuss the two principles on which evolution...Ch. 29 - 2. Evolution, which involves genetic changes in a...Ch. 29 - Prob. 3CONQCh. 29 - Prob. 4CONQCh. 29 - 5. Would each of the following examples of...Ch. 29 - Distinguish between anagenesis and cladogenesis....Ch. 29 - 7. Describe three or more genetic mechanisms that...Ch. 29 - Explain the type of speciation (allopatric,...Ch. 29 - Prob. 9CONQCh. 29 - Prob. 10CONQCh. 29 - Discuss the major differences among allopatric,...Ch. 29 - Prob. 12CONQCh. 29 - Prob. 13CONQCh. 29 - Would the rate of deleterious or beneficial...Ch. 29 - 15. Which would you expect to exhibit a faster...Ch. 29 - Prob. 16CONQCh. 29 - 17. Plant seeds contain storage proteins that are...Ch. 29 - Take a look at the -globin and -globin amino acid...Ch. 29 - Compare and contrast the neutral theory of...Ch. 29 - Prob. 20CONQCh. 29 - 21. As discussed in Chapter 27, genetic variation...Ch. 29 - Prob. 22CONQCh. 29 - Two populations of snakes are separated by a...Ch. 29 - 2. Sympatric speciation by allotetraploidy has...Ch. 29 - 3. Two diploid species of closely related frogs,...Ch. 29 - A researcher sequenced a portion of a bacterial...Ch. 29 - F1hybrids between two species of cotton,Gossypium...Ch. 29 - 6. A species of antelope has 20 chromosomes per...Ch. 29 - Prob. 7EQCh. 29 - 8. Prehistoric specimens often contain minute...Ch. 29 - From the results of the experiment of Figure...Ch. 29 - InChapter 23, a technique called fluorescence in...Ch. 29 - Prob. 11EQCh. 29 - 12. Discuss how the principle of parsimony can be...Ch. 29 - 13. A homologous DNA region, which was 20,000 bp...Ch. 29 - Prob. 14EQCh. 29 - Prob. 1QSDCCh. 29 - 2. Compare the forms of speciation that are slow...Ch. 29 - 3. Do you think that Darwin would object to the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the table below is a short gene sequence in 4 closely related taxa and an outgroup. Based on comparisons of this DNA sequence, determine the placement of these four taxa in the phylogenetic tree below. Clearly identify the taxon (P, Q, R, or S) that corresponds to each branch tip (1, 2, 3, or 4). Based on your constructed tree, is Species P more closely related to Species Q or Species S? Justify your answer.arrow_forwardSpecies A, B, and C are related according to the phylogeny below (A,(B,C)). Species A and C diverged 10,000,000 generations ago, and species B and C diverged 100,000 generations ago. All three species are diploids. The mutation rate in their genomes is 1×10−9 mutations per basepair per generation. A gene found in all three species is 1,000 bp long. 75% of mutations in the gene are deleterious and 0% are beneficial. Use this information to answer the following questions. a) If there are 20 polymorphic synonymous sites in the gene in species A, how many non-synonymous sites do you expect to be polymorphic? Assume all synonymous changes are neutral. b) In species B, there are an average of two pairwise differences between individuals within the gene. What is the effective population size of species B? c) What do you expect FST to be between species B and C? Assume no migration between the species after they diverged.arrow_forwardSpecies A, B, and C are related according to the phylogeny below (A,(B,C)). Species A and C diverged 10,000,000 generations ago, and species B and C diverged 100,000 generations ago. All three species are diploids. The mutation rate in their genomes is 1×10−9 mutations per basepair per generation. A gene found in all three species is 1,000 bp long. 75% of mutations in the gene are deleterious and 0% are beneficial. Use this information to answer the following questions. a) Species A has 100,000 diploid individuals. How many new mutations arise per basepair per generation in species A? b) What is the gene’s neutral mutation rate per basepair per generation? c) What is the expected rate of fixation of neutral mutations in the gene? d) How many neutral substitution do you expect to observe if you compared the gene between species A and C?arrow_forward
- Imagine you are studying two eukaryotic species. The genome of Species A is 100 Mb in size. The genome of Species B is 500 Mb in size. Based only on this information, which of the following statements are accurate? Species B is a more complex organism than Species A. None of the other statements can be made based solely on the information in the question. Species B has more genes than Species A. Species B has more chromosomes, more genes, and is more complex than Species A. Species B has more chromosomes than Species A.arrow_forwardAsaparrow_forwardNext fill out the following table noting how many derived traits are shared for each pair of ingroup species. Species A Species B Species C Species D Species E Species F Species A Species B X X Species C X X X Species D X Species E X X Species F X X X X Use the above matrix to draw a cladogram depicting the phylogenetic relationships among all seven species. Start by grouping the pairs that have the most shared derived traits and then linking groups together. This is difficult to describe so look at the example matrix and cladogram below and then just give it a try, and ask for help if you get stuck. We will go through this as a group before lab is over to make sure everyone understands. Look at the hypothetical example first. Phylogenetic Systematics Page 5 Example Matrix Of Shared Derived Traits: Species Species Species Species A В C D Species A Species B Species C Species D 1 1 3 X Building a cladogram from above matrix: Step 1. Species C and D share the most derived traits so link…arrow_forward
- A researcher studying two species (species 1 and species 2) sequences a short stretch of eight codons from the same gene, gene B, in each and compares them. Species 1 and species 2 had a most recent common ancestor 50 million years ago. Species 1: ATC GGG CGG GAC TTA CTA TAT GCC Species 2: ATT GGG CGG GAC TTG CTA TAT GCC Given the differences between the sequences of the two species' genes shown here, what evolutionary force can you predict is most likely in operation on gene B?arrow_forwardThe number of possible trees resulting from phylogenetic analysis grows exponentially with the number taxa, such that in a 22 taxon analysis there are more possible unrooted trees than there are stars in the universe. A) True B) False C) It depends on the inference method and optimality criteria used. D) Number of taxa and number of unrooted tree possibilities are unrelated in phylogenetic analysis.arrow_forwardOn the cladogram below, the letters indicate nodes and characters. What is the most recent common ancestor of taxa 3 and 7? (You can type either an upper-case or lower-case letter. Either is acceptable.) Таxon 1 Тахon 2 B. D Тахon 3 Таxon 4 Таxon 5 P E. Тахon 6 Тахon 7 G Таxon 8 Тахon 9 M Taxon 10 Таxon 11 Taxon 12 Taxon 13 Narrow_forward
- Study the sequences below. Construct a molecular cladogram from the different amino acid sequences given. Assume that the sequences are already compared between species and have been aligned as shown. Species 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 ACT G G C G AT C G 1 2 3 4 5 A C A G ACT G C G C G C T T C G T T C G T C G C A T C G T A C G A C G A C T G C C G T T C G C A T C G T A C G A C T G GAA C G GATC GA C G A T C G C A T C G т A C Garrow_forwardA scientist is attempting to build a cladogram that shows the evolutionary closeness of three organisms in relation to humans. After doing DNA analysis, they determine that the organisms share the following percentages of DNA: Organism A and humans share 85% of their DNA. Organism B and humans share 80% of their DNA. Organism C and humans share 90% of their DNA. Based on this information, which order should they go on the cladogram (from least related to most related)?arrow_forwardYou want to make a phylogenetic tree of a group of three related species of lizards that live on an island. Their genome sequences are highly similar except for a gene that controls body size. In that region of the genome, one of the lizard species has one copy of the growth control gene (L1), the second species has a duplication of the growth control gene (L2) and the third species has three copies of the same gene (L3). The lizard species show an increase in size depending on how many copies of the growth control gene they have (L1 is smallest, L2 is medium-sized and L3 is largest). Is this enough information to determine the phylogenetic relationships between the species, and predict which of the species arrived on the island first (and is the ancestral species)? Yes, because the ancestral lizard genome probably had a single copy of the growth control gene and after arriving on the island it was duplicated, resulting in species L2, and then another duplication occurred resulting in…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License