Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 32ESP
In humans, congenital heart disease is a common birth defect that affects approximately 1 out of 125 live births. Using reverse transcription PCR (RT-PCR) Samir Zaidi and colleagues [(2013) Nature 498:220.223] determined that approximately 10 percent of the cases resulted from point mutations, often involving histone function. To capture products of gene expression in developing hearts, they used oligo(dT) in their reverse transcription protocol.
- (a) How would such a high %T in a primer influence annealing temperature?
- (b) Compared with oligo(dT) primers, a pool of random sequence primers requires a trickier assessment of annealing temperature. Why?
- (c) If one were interested in comparing the quantitative distribution of gene expression in say, the right and left side of a developing heart, how might one proceed using RT-PCR?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The accompanying photo shows a sequencing gel from the original study that first sequenced the cystic fibrosis gene (J. R. Riordan et al. 1989. Science 245:1066–1073). From the photo, determine the sequence of the normal copy of the gene and the sequence of the mutated copy of the gene. Identify the location of the mutation that causes cystic fibrosis. (Hint: The CF mutation is a 3-bp deletion.)
Mutations in the CFTR gene result in cystic fibrosis in humans, a conditions in which abnormal secretions are present in the lungs, pancreas, and sweat glands. The gene was mapped to a 500-kb region on chromosome 7 containing 3 candidate genes.
a)Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTR gene?
b)How would you prove that your chosen candidate is the CFTR gene?
Most organisms display a circadian rhythm, a cycling of biological processes that is roughly synchronized with day length. In Drosophila, pupae eclose (emerge as adults after metamorphosis) at dawn.
a)Using this knowledge how would screen for Drosophila mutants that have an impaired circadian rhythm?
b)In each case, how would you clone the genes you identified by mutation?
Chapter 20 Solutions
Concepts of Genetics (12th Edition)
Ch. 20 - A plasmid that is both ampicillin and tetracycline...Ch. 20 - You have just created the worlds first genomic...Ch. 20 - What undesirable or unforeseen consequences might...Ch. 20 - Do we have the ethical right to alter the genomes...Ch. 20 - Should these new technologies be regulated...Ch. 20 - HOW DO WE KNOW? In this chapter we focused on how...Ch. 20 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 20 - What roles do restriction enzymes, vectors, and...Ch. 20 - The human insulin gene contains a number of...Ch. 20 - Although many cloning applications involve...
Ch. 20 - Using DNA sequencing on a cloned DNA segment, you...Ch. 20 - Restriction sites are palindromic; that is, they...Ch. 20 - List the advantages and disadvantages of using...Ch. 20 - What are the advantages of using a restriction...Ch. 20 - In 1975, the Asilomar Conference on Recombinant...Ch. 20 - In the context of recombinant DNA technology, of...Ch. 20 - If you performed a PCR experiment starting with...Ch. 20 - Prob. 13PDQCh. 20 - Prob. 14PDQCh. 20 - You have recovered a cloned DNA segment from a...Ch. 20 - Prob. 16PDQCh. 20 - Although the capture and trading of great apes has...Ch. 20 - Prob. 18PDQCh. 20 - Prob. 19PDQCh. 20 - Prob. 20PDQCh. 20 - Traditional Sanger sequencing has largely been...Ch. 20 - How is fluorescent in situ hybridization (FISH)...Ch. 20 - What is the difference between a knockout animal...Ch. 20 - Prob. 24PDQCh. 20 - When disrupting a mouse gene by knockout, why is...Ch. 20 - Prob. 26PDQCh. 20 - Prob. 27PDQCh. 20 - As you will learn later in the text (Special...Ch. 20 - The gel presented here shows the pattern of bands...Ch. 20 - A widely used method for calculating the annealing...Ch. 20 - Most of the techniques described in this chapter...Ch. 20 - In humans, congenital heart disease is a common...Ch. 20 - The U.S. Department of Justice has established a...Ch. 20 - Prob. 34ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Genome annotation refers to ... 1.) lining up overlapping regions in short shotgun sequencing reads to assemble larger contiguous DNA sequences (contigs/scaffolds). 2.) using long-read sequencing platforms (such as PacBio or Oxford Nanopore) to gather information about the epigenetic status of each region of a sequenced genome. 3.) the process of predicting which parts of a genome sequence code for functional products (such as protein-coding genes), what those products do, and assigning them names. 4.) sequencing messengeRNA measure the relative expression levels of genes in one or more tissue samples.arrow_forwardBy whole-exome sequencing, you have identified an early termination mutation in KLHL4 in a human patient with an undiagnosed blood vessel anomaly. There is almost nothing known about the function of this gene, and no existing animal models! To begin to understand its function, you decide to use the zebrafish model. You first want to know where in the embryo this gene is expressed. Which technique would you use to identify the cell type that expresses klhl4 mRNA in zebrafish embryos? You find that this gene is expressed in endothelial cells, which line blood vessels. Intrigued by this finding, you next decide to disrupt the gene in zebrafish using CRISPR/Cas9. The DNA sequence that you want to target is below. What is the sequence of your 20-base guide RNA? 5’ TAGCAATTATGCGCGCTAGCAATTGCGTAGGTCATAATGCAGCTGAC 3’ 3’ ATCGTTAATACGCGCGATCGTTAACGCATCCAGTATTACGTCGACTG 5’ After injecting the gRNA with Cas9, what are potential outcomes? Enter true or false.…arrow_forwardGeneticists often use ethylmethane sulfonate (EMS) to induce mutations in Drosophila. Why is EMS a mutagen of choice for genetic research? What would be the effects of EMS in a strain of Drosophila lacking functional mismatch repair systems?arrow_forward
- Geneticists often use the alkylating agent ethylmethane sulfonate (EMS; see Figure 15.6) to induce mutations in Drosophila. Why is EMS a mutagen of choice for genetic research? What would be the effects of EMS in a strain of Drosophila lacking functional mismatch repair systems?arrow_forwardAlthough several different mammalian species have been cloned, the efficiency of this process is extremely low. Often tens or even hundreds of oocytes must be implanted with donor nuclei to obtain one healthy live birth. Many researchers believe the difficulties with cloning reside in the epigenetic modifications, such as DNA and histone methylation, that occur within various cells during an individual’s life. How do you suspect such modifications might affect the success of an experimentarrow_forwardThere is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods, steps, and key substances you need to obtain to use the following techniques in experimental design to study the gene: - In situ hybridization (to find the mRNA) - Immunohistochemistry (to find the protein) - CRISPR-Cas9 (for loss of function) - Expression vector (for gain of function)arrow_forward
- Retinoblastoma is an extremely rare cancer of the retina in the eye. The disease mainly affects children up to the age of 5 years because it can only occur while the nerve precursor cells are still dividing. In its nonhereditary form, a tumor usually occurs in only one eye; in its hereditary form, multiple tumors develop in both eyes.To explore the basis for these differences, a cDNA clone of the Rb gene was used to probe the structure of the gene in cells from normal individuals and from individuals with nonhereditary or hereditary retinoblastoma. As shown in the figure Part A, normal individuals have four restriction fragments (A, B, C, and D) that hybridize to the Rb cDNA probe, indicating that each restriction fragment encodes at least one Rb exon. Samples from fibroblasts and tumor cells of affected persons show some differences in the patterns of hybridization, with some bands missing entirely and some bands present at half intensity. The order of the restriction fragments in the…arrow_forwardYou isolate genomic DNA from brain cells and heart cells and use PCR to amplify the promoter region of gene A, known to be methylated under certain circumstances. To determine which cell type has methylation in this region, you treat the DNA with sodium bisulfite, sequence the regions from both brain and heart cells, and compare to the untreated sequence, as shown below. Untreated: ATCCGGCGACG Brain: ATCCGGCGACG Heart: ATCTGGTGACG Given these results, which cell type would you expect to transcribe MORE "A" mRNA?arrow_forwardTransformation is a process in which bacteria take up new DNA released by dead cells and integrate it into their own genomes. In Streptococcus pneumoniae (which causes many cases of pneumonia, inner-ear infections, and meningitis), the ability to carry out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com regulon is activated in response to a protein called competence-stimulating peptide (CSP), which is produced by the bacteria and exported into the surrounding medium. When enough CSP accumulates, it attaches to a receptor on the bacterial cell membrane, which then activates a regulator protein that stimulates the transcription of genes within the com regulon and sets in motion a series of reactions that ultimately result in transformation. Does the com regulon in Streptococcus pneumoniae exhibit positive or negative control? Explain your answerarrow_forward
- The genome of Drosophila melanogaster, a fruit fly, was sequenced in 2000. However, this “completed” sequence did not include most heterochromatin regions. The heterochromatin was not sequenced until 2007 (R. A. Hoskins et al. 2007. Science 316:1625–1628). Most completed genome sequences do not include heterochromatin. Why is heterochromatin usually not sequenced in genome-sequencing projects?arrow_forwardResearchers have identified a gene (FR) responsible for watermelon resistance to infection by Dacus curcurbitae (a close relative of Drosophila melanogaster). They isolate RNA from resistant (FR+) and sensitive (fr-) watermelons and use a probe that will recognize both FR+ and fr- transcripts. They also isolate protein from resistant and sensitive watermelons and perform a Western blot using an antibody that can recognize the fr- and FR+ protein. Describe the results illustrated below and give a plausible molecular explanation for these observations.arrow_forwardTransformation is a process in which bacteria take up new DNA released by dead cells and integrate it into their own genomes. In Streptococcus pneumoniae (which causes many cases of pneumonia, inner ear infections, and meningitis), the ability to carry out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com regulon is activated in response to a protein called competence-stimulating peptide (CSP), which is produced by the bacteria and exported into the surrounding medium. When enough CSP accumulates, it attaches to a receptor on the bacterial cell membrane. The receptor then activates a regulator protein that stimulates the transcription of genes within the com regulon and sets in motion a signaling cascade that results in transformation. Does the com regulon in S. pneumoniae exhibit positive or negative control? Explain your answer. negative control, wherein CSP is a repressor of the com pathway, which stimulates transcription negative control,…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY