Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 20, Problem 13PDQ
Summary Introduction
To determine: The origin of the slow band as a product of ligation by HindIII restriction enzyme.
Introduction: HindIII is site-specific deoxyribonuclease restriction enzyme. It is isolated from bacteria Haemophilus influenzae. It cleaves the DNA palindromic sequence AAGCTT in the presence of a cofactor via hydrolysis.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The
plasmid is then used to transform E.coli colls Is the following statement True or False?
Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid.
Clal Hindlll
EcoRI
Pvul
BamHI
Pstl
amp
tet
PBR322
-Sall
ori
rop
Pvull
True
False
Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer.
A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing.
Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance:
> putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…
You have just carried out a transformation using a plasmid (possessing a
Amp-resistance gene) that was 0.001 ug/ul in concentration. You added
10 ul of this plasmid to 100 ul of a bacterial cell suspension. Then
you
added 250 ul of LB following heat shock. After plating 200 ul of this cell
suspension with LB onto a LBA plate, you observe 8 colonies on this
plate. What is the transformation efficiency of this plasmid (in
colonies/ug of plasmid) based on these results?
about 1400
O about 80O
about 4000
O about 400O
O about 8000
f6
米
IO
fs
fg
f1o
19
08.
O OO
Chapter 20 Solutions
Concepts of Genetics (12th Edition)
Ch. 20 - A plasmid that is both ampicillin and tetracycline...Ch. 20 - You have just created the worlds first genomic...Ch. 20 - What undesirable or unforeseen consequences might...Ch. 20 - Do we have the ethical right to alter the genomes...Ch. 20 - Should these new technologies be regulated...Ch. 20 - HOW DO WE KNOW? In this chapter we focused on how...Ch. 20 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 20 - What roles do restriction enzymes, vectors, and...Ch. 20 - The human insulin gene contains a number of...Ch. 20 - Although many cloning applications involve...
Ch. 20 - Using DNA sequencing on a cloned DNA segment, you...Ch. 20 - Restriction sites are palindromic; that is, they...Ch. 20 - List the advantages and disadvantages of using...Ch. 20 - What are the advantages of using a restriction...Ch. 20 - In 1975, the Asilomar Conference on Recombinant...Ch. 20 - In the context of recombinant DNA technology, of...Ch. 20 - If you performed a PCR experiment starting with...Ch. 20 - Prob. 13PDQCh. 20 - Prob. 14PDQCh. 20 - You have recovered a cloned DNA segment from a...Ch. 20 - Prob. 16PDQCh. 20 - Although the capture and trading of great apes has...Ch. 20 - Prob. 18PDQCh. 20 - Prob. 19PDQCh. 20 - Prob. 20PDQCh. 20 - Traditional Sanger sequencing has largely been...Ch. 20 - How is fluorescent in situ hybridization (FISH)...Ch. 20 - What is the difference between a knockout animal...Ch. 20 - Prob. 24PDQCh. 20 - When disrupting a mouse gene by knockout, why is...Ch. 20 - Prob. 26PDQCh. 20 - Prob. 27PDQCh. 20 - As you will learn later in the text (Special...Ch. 20 - The gel presented here shows the pattern of bands...Ch. 20 - A widely used method for calculating the annealing...Ch. 20 - Most of the techniques described in this chapter...Ch. 20 - In humans, congenital heart disease is a common...Ch. 20 - The U.S. Department of Justice has established a...Ch. 20 - Prob. 34ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker(such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?arrow_forwardA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?arrow_forwardAfter transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.arrow_forward
- A plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: If recombinant cells were plated on medium containingampicillin or tetracycline and medium withboth antibiotics, on which plates would you expectto see growth of bacteria containing plasmids withDrosophila DNA inserts?arrow_forwardWhen using a conventional plasmid cloning vector containing a b-galactosidase gene, it is possible to perform a "blue-white screen" to determine which bacteria have taken up a plasmid into which a DNA fragment as been inserted, as opposed to those that have taken up just reclosed plasmid vector, by growing the transformed cells on nutrient agar plates containing the artificial b-gal substrate X-gal. Will bacteria that have taken up a plasmid into which a DNA fragment has been inserted form a blue colony or a white colony when grown on this medium? Briefly explain why these bacteria would form a colony of the color you chose.arrow_forwardA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: Which antibiotic should be added to the mediumto select cells that have incorporated a plasmid?arrow_forward
- A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEp), Yeast Integrating Plasmid (YIp) and Yeast Replicating Plasmid (YRp). Among these three vectors, YIp has the lowest transformation frequency and copy number per cell. Explain why Ylp is still popularly used despite its limitations.arrow_forwardTo determine if the antibiotic resistance in MH1 was carried on a plasmid, you first isolate the plasmid in MH1 using the plasmid DNA purification technique. Then, you transform bacteria that are not resistant to penicillin/ampicillin with the plasmid isolated from MH1. For the bacterial transformation experiment, you set up the three controls listed below. Match each control with its appropriate purpose (i.e. what it is controlling for) Please note: Transformed bacteria are bacteria that received the plasmid from MH1 and untransformed bacteria are bacteria that did not receive a plasmid. Testing to ensure that the bacteria used in the transformation experiment are viable (i.e. can grow on LB media) (Choose) [ Choose ) after transformation. Untransformed bacteria plated on LB only plate Testing to ensure that the bacteria used in the transformation experiment are viable (ie. can grow on LB media) before transformation. Transformed bacteria plated on LB only plate Untransformed bacteria…arrow_forwardPlease DESCRIBE, in outline form, the method you will use to select for bacterial cells that have taken up the pL311 plasmid, and to screen those cells for the presence of plasmids that are likely to contain a cloned gene. Be sure to mention the specific media you will use. In addition, please explain the rationale behind this specific selection and screening procedure. (Remember that you have available the following types of media: (i) media containing neither kanamycin nor X-gal, (ii) media containing BOTH kanamycin and X-gal, (iii) media containing tetracycline, and (iv) media containing ampicillin.arrow_forward
- Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.arrow_forwardUsing the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.arrow_forwardA cloning vector map is shown below. EcoRI Bam Ban Hind P-galactosidase Amp Bam Bam EcoRI Ori C Which restriction site is best for inserting a DNA fragment for selection of chimeric plasmid containing colonies? 1) They're all equally good. 2) Hindll 3) EcoRI 4) BamHIarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license