Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 6PDQ
Using DNA sequencing on a cloned DNA segment, you recover the
CAGTATGGATCCCAT
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
(i) Which of the DNA sequences shown below can be cut by using restriction enzyme?
Explain your answer by analysing the sequences.
Sequence A: 5'-AATGGCTGCCGTGGCTTA-3'
Sequence B: 5'-TAACCCTGCGCATTTGCA-3'
(ii) Given a DNA sequence, 5'-TACGAATTCGTAA-3' and EcoRI cutting site as below.
Write out the double stranded fragments that are generated when EcoRI works on this
DNA sequence.
EcoR I
5.. GAATTC...3'
3...CTTAAG...5'
Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.
Chapter 20 Solutions
Concepts of Genetics (12th Edition)
Ch. 20 - A plasmid that is both ampicillin and tetracycline...Ch. 20 - You have just created the worlds first genomic...Ch. 20 - What undesirable or unforeseen consequences might...Ch. 20 - Do we have the ethical right to alter the genomes...Ch. 20 - Should these new technologies be regulated...Ch. 20 - HOW DO WE KNOW? In this chapter we focused on how...Ch. 20 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 20 - What roles do restriction enzymes, vectors, and...Ch. 20 - The human insulin gene contains a number of...Ch. 20 - Although many cloning applications involve...
Ch. 20 - Using DNA sequencing on a cloned DNA segment, you...Ch. 20 - Restriction sites are palindromic; that is, they...Ch. 20 - List the advantages and disadvantages of using...Ch. 20 - What are the advantages of using a restriction...Ch. 20 - In 1975, the Asilomar Conference on Recombinant...Ch. 20 - In the context of recombinant DNA technology, of...Ch. 20 - If you performed a PCR experiment starting with...Ch. 20 - Prob. 13PDQCh. 20 - Prob. 14PDQCh. 20 - You have recovered a cloned DNA segment from a...Ch. 20 - Prob. 16PDQCh. 20 - Although the capture and trading of great apes has...Ch. 20 - Prob. 18PDQCh. 20 - Prob. 19PDQCh. 20 - Prob. 20PDQCh. 20 - Traditional Sanger sequencing has largely been...Ch. 20 - How is fluorescent in situ hybridization (FISH)...Ch. 20 - What is the difference between a knockout animal...Ch. 20 - Prob. 24PDQCh. 20 - When disrupting a mouse gene by knockout, why is...Ch. 20 - Prob. 26PDQCh. 20 - Prob. 27PDQCh. 20 - As you will learn later in the text (Special...Ch. 20 - The gel presented here shows the pattern of bands...Ch. 20 - A widely used method for calculating the annealing...Ch. 20 - Most of the techniques described in this chapter...Ch. 20 - In humans, congenital heart disease is a common...Ch. 20 - The U.S. Department of Justice has established a...Ch. 20 - Prob. 34ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut using three restriction enzymes, namely Kpnl, Sall and EcoRI, it yields four fragments with sizes of 390 bR. 810 bp, 270 bp www and 330 bp. Kpnl Sall EcoRI 390 810 270 330 1800 bp 1. If you were to subject this digested DNA to agarose gel electrophoresis, what would your gel look like? Draw a detailed picture of your gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. 2. You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exac fragment sizes are not important.arrow_forwardAssume that a plasmid is 4700 base pairs in length and has restriction sites for a given restriction enzyme at the following locations: 800, 1400, 2900, and 3600. List the fragments by size that are ! expected when the plasmid is fully digested the restriction enzyme.arrow_forwardA small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forward
- Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forwardThe map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forward
- The gene you are asked to clone is 30,000 bps in length. When you are choosing a suitable Restriction Endonuclease, what criteria about the enzyme can you deduce from the gene length?arrow_forwardRestriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translatearrow_forwardBelow is a diagram of the vector you are planning to use. You identify four restriction enzyme recognition sites in the vector as indicated in the diagram below. The distance between the restriction sites are indicated by numbers (in kilo base pairs). ori ВатHI ВатHI 2 ЕcoRI Kpnl If you digest the vector with a combination of EcoRI and BamHI and run the resulting DNA fragments on a gel, which lane would represent the expected result? (Lane 1 contains the DNA size marker.) А В с (kbp) 8 Promoterarrow_forward
- A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA band while linear DNA shows two fragments. Explain.arrow_forwardYou are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E+H E+X H+x Kb +4.3 +2.8 -+2.5 -2.0 - -1.8 +1.5 -1.0 12 F0.8 +0.5 a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?arrow_forwardThe figure below shows the recognition sequences and cleavage positions of three restriction enzymes.You plan to ligate DNA from two different sources. The target DNA is digested with BamHI,and the insert DNA is digested with BglII, and the resulting fragments mixed and incubatedwith DNA ligase. a) Write out the sequence (in double-stranded format) of the longest insert fragment that will result after BglII digestion, ensure the nature of the overhangs is clear.b) Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. c) Assume the ligation reaction was successful and you have generated a recombinant DNAmolecule. Which of the three enzymes listed above can be used to excise the insert DNAfrom the target? Motivate your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License