Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 20, Problem 30ESP
A widely used method for calculating the annealing temperature for a primer used in PCR is 5 degrees below the melting temperature, Tm(°C), which is computed by the equation 81.5 + 0.41 × (%GC) – (675/N), where %GC is the percentage of GC
5′-TTGAAAATATTTCCCATTGCC-3′
compute the annealing temperature for PCR. What is the relationship between Tm (°C) and %GC? Why? (Note: In reality, this computation provides only a starting point for empirical determination of the most useful annealing temperature.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You have a 20 mg/ml of Ethidium bromide stock solution. You need to a final concentration of 2ug/ml into a Agarose solution to visualize DNA. What is the dilution factor?
Give typing answer with explanation and conclusion
Show the calculations for the preparation of 0.01%, 0.001%, 0.0001%, 0.00001% standard DNA solutions via serial dilution from a 0.1% stock solution.
Prepare 10.0 mL of 0.10% standard DNA solution using acetate buffer pH 4.6 as solvent.
Prepare four different concentrations of the 0.10% standard DNA solution from step 1 via serial dilution to obtain 0.01%, 0.001%, 0.0001%, 0.00001% standard DNA solutions.
Obtain seven clean and dry test tubes. Place 1.50 mL solutions in each tube as follows:
Table 2.1. Set-up for the diphenylamine assay.
Test tube #
Content
1 (blank)
acetate buffer pH 4.6
2
0.10% standard DNA
3
0.01% standard DNA
4
0.001% standard DNA
5
0.0001% standard DNA
6
0.00001% standard DNA
7
DNA extract from Part I
Add 3.50 mL diphenylamine reagent to each tube, swirl each tube to thoroughly mix the contents and heat for 10 mins in a boiling water bath. Cool immediately under tap water.
Read absorbances at 595 nm.…
A plot showing the % of denaturation as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of
Y= 0.0074 X - 0.044.
(where Y is the % of denaturation and X is the temperature in °C)
Question: Calculate the melting point of this DNA in °C.
Chapter 20 Solutions
Concepts of Genetics (12th Edition)
Ch. 20 - A plasmid that is both ampicillin and tetracycline...Ch. 20 - You have just created the worlds first genomic...Ch. 20 - What undesirable or unforeseen consequences might...Ch. 20 - Do we have the ethical right to alter the genomes...Ch. 20 - Should these new technologies be regulated...Ch. 20 - HOW DO WE KNOW? In this chapter we focused on how...Ch. 20 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 20 - What roles do restriction enzymes, vectors, and...Ch. 20 - The human insulin gene contains a number of...Ch. 20 - Although many cloning applications involve...
Ch. 20 - Using DNA sequencing on a cloned DNA segment, you...Ch. 20 - Restriction sites are palindromic; that is, they...Ch. 20 - List the advantages and disadvantages of using...Ch. 20 - What are the advantages of using a restriction...Ch. 20 - In 1975, the Asilomar Conference on Recombinant...Ch. 20 - In the context of recombinant DNA technology, of...Ch. 20 - If you performed a PCR experiment starting with...Ch. 20 - Prob. 13PDQCh. 20 - Prob. 14PDQCh. 20 - You have recovered a cloned DNA segment from a...Ch. 20 - Prob. 16PDQCh. 20 - Although the capture and trading of great apes has...Ch. 20 - Prob. 18PDQCh. 20 - Prob. 19PDQCh. 20 - Prob. 20PDQCh. 20 - Traditional Sanger sequencing has largely been...Ch. 20 - How is fluorescent in situ hybridization (FISH)...Ch. 20 - What is the difference between a knockout animal...Ch. 20 - Prob. 24PDQCh. 20 - When disrupting a mouse gene by knockout, why is...Ch. 20 - Prob. 26PDQCh. 20 - Prob. 27PDQCh. 20 - As you will learn later in the text (Special...Ch. 20 - The gel presented here shows the pattern of bands...Ch. 20 - A widely used method for calculating the annealing...Ch. 20 - Most of the techniques described in this chapter...Ch. 20 - In humans, congenital heart disease is a common...Ch. 20 - The U.S. Department of Justice has established a...Ch. 20 - Prob. 34ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You extract DNA from 200, You pipette 200 microlitres of this extraction sample into a 3-ml cuvette and make up to 3.0 ml using buffer. The absorbance at 260 nm (A260) of the solution in the cuvette is 0.2 (Remember: an A 260 of 1.0 corresponds to a DNA concentration in the cuvette solution of 50 micrograms per ml). Calculate the total amount of DNA in 100g wheat germ, assuming that the extraction efficiency of DNA from wheat germ during your lab protocol is 40%. Please fill out each of the boxes in the Table below What to Calculate Calculation / Result Marks (x / 100) 12/100 DNA concentration in cuvette solution (in microgram per ml) Dilution factor of DNA sample in cuvette 12/100 12/100 Total amount (microgram) of DNA in the entire extraction sample Total amount (milligram) of DNA in 100g wheat germ 24/100 assuming an extraction efficiency of 40%arrow_forwardWhat is the concentration of a DNA solution that absorbs 0.812 and 0.463 at 260 and 280 nm, respectively? Is the DNA solution considered to be good quality? Why or why not?arrow_forwardA facility says they need 15 μL of a 40 ng/μL solution of plasmid DNA for sequencing. The typical yield for a DNA miniprep 5 μg eluted in 50 μL of solution. What do you need to do (for example dilution) to send the appropriate amount to the facility? Show all math work with an explanation.arrow_forward
- You have a very concentrated sample of DNA which you need to dilute for sequencing 1:6000 with a final volume of 10 μl. How would you do this in four steps, using a serial dilution? Do not pipet less than 1 ul and do not make more than 10 ul per dilution. Describe how to do each dilution using the format suggested below.arrow_forwardIf the length of E.coli DNA is 1.36 mm, calculate the number of base pairs it containsarrow_forwardWhy is sodium acetate used in DNA precipitation by ethanol, rather than sodium chloride? (Hint – acetate is an organic ion. Chloride is not.)arrow_forward
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardOne gram of cultured human cells contains about 10^9 cells and occupies roughly 1 mL. if the average molecular mass of a base is 660 daltons and each cell contains 6,4 *10^9 bp, what mass of DNA is present in this one-gram sample? If all the DNA molecules in the sample were laid end to end to form a single thread. Would it be long enough to reach from the Earth to the Moon (385.000 kilometers).arrow_forwardTo carry out sequencing, you need to include 600 ng of DNA and a total of 6.4 pmol of sequencing primer. If your concentration of DNA (determined by A260 reading on a Nanodrop Spectrophotometer) is 89.0 ng/μL, how many μL of this sample do you need for a total of 600 ng?arrow_forward
- 1). What is the concentration of a solution of DNA with an OD260 of 0.3? ----I got 15 micrograms/mL (50 x 0.3) 2). How many microliters of this solution of DNA would you need if you wanted 1.5 micrograms?arrow_forwardA typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?arrow_forwardAssuming the average weight of a deoxynucleotide monophosphate (dNMP) is 327.0 g/mol, how many picomoles of DNA are present in 500ng of a 1000bp DNA fragment?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License