Concept explainers
a.
To determine:
The appearance of chromosome 1 after FISH having genotypes Del1/Del2.
Introduction:
Human chromosome 1 is a large metacentric chromosome. Some of the telomeric regions on the chromosome were barcoded by multicolor banding. Fluorescence In situ Hybridization technique (FISH) is used to label the DNA probes.
b.
To determine:
The appearance of chromosome 1 after FISH having genotypes Del1/+.
Introduction:
Multicolor banding is done towards the telomeric end of chromosome 1 using different fluorescent dyes. This technique of banding is called FISH. The banding pattern is unique for different genotypes.
c.
To determine:
The appearance of chromosome 1 after FISH having genotypes Inv1/+.
Introduction:
Inversion refers to a type of chromosomal mutation in which a segment of a chromosome gets reversed from one end to the other. Inversion is of two types, paracentric and pericentric inversion. Pericentric inversion includes the centromere, whereas; paracentric inversion does not involve centromere.
d.
To determine:
The appearance of chromosome 1 after FISH having genotypes Inv2/+.
Introduction:
Inversion can be classified into two types, paracentric and pericentric inversion. Pericentric inversion includes the centromere, whereas; paracentric inversion does not involve centromere.
e.
To determine:
The appearance of chromosome 1 after FISH having genotypes Inv2/Inv2.
Introduction:
The technique of banding the chromosomal region by using different fluorescent dyes is called FISH. The banding pattern is unique for different genotypes.
Want to see the full answer?
Check out a sample textbook solutionChapter 13 Solutions
Genetics: From Genes to Genomes
- DNA is extracted from the blood cells of two different humans, individuals 1 and 2. In separate experiments, the DNA from each individual is cleaved by restriction endonucleases A, B, and C, and the fragments are separated by electrophoresis. A hypothetical map of a 10,000 bp (base pair) segment of a human chromosome is shown (1 kbp= 1,000 bp). Individual 2 has point mutations that eliminate restriction recognition sites B* and C*. After the 10kbp segment is digested with each restriction endonuclease A, B, and C one by one, samples are loaded onto an agarose gel for electrophoresis for analysis. I would like you to draw the result of gel electrophoresis. To answer the question, first, draw the whole gel image (on the right) on your answer sheet, then indicate where you expect to see the bands on the gel. (Hint1: Same-size bands will appear at the same position. Hint 2: On the gel bands from individuals 1 and 2 might be at different positions.) The left lane (with an M label on the…arrow_forwardA person with a rare genetic disease has a sample of her chromosomessubjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes look cytologically normal, the probe does not bind to this person’s chromosomes. How would you explain these results? How would you use this information to positionally clone the gene that is related to this disease?arrow_forwardYou have two tubes, each with a pair of DNA fragments inside them. Tube #1 has fragments that are 500bp and 1000 bp in length. Tube #2 has fragments that are 7500bp and 8000bp in size. If you were to perform agarose gel electrophoresis and run the contents of each tube in two separate lanes on the same gel, what would you expect to see? O That the difference between the distances migrated by the two fragments in Tube #1 was much greater than the difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was the same as difference between the distances migrated by the two fragments in Tube #2. O That the difference between the distances migrated by the two fragments in Tube #1 was much less than the difference between the distances migrated by the two fragments in Tube #2. O It is not possible to estimate what we would expect to see.arrow_forward
- A technique called fluorescence in situ hybridization (FISH) is described. In this method, a labeled piece of DNA is hybridized to a set of chromosomes. Let’s suppose that you cloned a piece of DNA from G. pubescens and used it as a labeled probe for in situ hybridization. What would you expect to happen if this DNA probe were hybridized to the G. speciosa or G. tetrahit chromosomes? Describe the expected results.arrow_forwardE 1 kb 1 kb DAK 6 kb Gene X E1 kb B 5 kb. Gene Z E₁kb 1 kb The figure above shows a linear chronosome containing Gene X and Gene Z and the location of sites for the restriction enzymes EcoRI (E) and BamHI (B). Refer to this map as you answer the question below. If you digest this DNA with EcoRI, then perform agarose gel electrophoresis, how many bands, and what sizes, would you expect to see? a) Two bands on the gel corresponding to the sizes 2 kb and 6 kb b) Three bands on the gel corresponding to the sizes 1 kb, 6 kb and 8 kb. c) Three bands on the gel corresponding to the sizes 1 kb, 5 kb and 6 kb d) Four bands on the gel corresponding to the sizes 1 kb, 2 kb, 5 kb and 6 kb e) Four bands on the gel corresponding to the sizes 2 kb, 3 kb, 4 kb and 8 kbarrow_forwardIn each of the illustrations below, a segment of a chromosome has two copies of a transposable element. In panel a, they are oriented in the same direction, whereas in panel b they are in opposite directions. A double strand break occurs in element A and is repaired by homologous recombination using element B as a repair template. For each case, what will the chromosome look like after homologous recombination occurs? Choose one of the five options below, 1-5.arrow_forward
- A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’arrow_forwardA closed circular plasmid B-DNA (10.5 bp/turn) consists of 231 base pairs and has Wr= -1 (ccDNAa). Then a topoisomerace acts upon ccDNAa leading to strain relaxation caused by supercoiling, thus, a topoisomere ccDNAb is formed. Finally, EtBr (Ethidium bromide) intercalator is added leading to ccDNAc which has 11bp/turn. a) Calculate superhelical densities σa, σb, σc of the three plasmids ccDNAa, ccDNAb and ccDNAc, respectively. b) Which of the three topoisomeres will move faster in agarose gel electrophoresis and why?arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forward
- In the Holliday model for homologous recombination shown, the resolution steps can produce recombinant or nonrecombinantchromosomes. Explain how this can occur.arrow_forwardE. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope 15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N. Using a solid line to represent a heavy polynucleotide chain and a dashed line for a light chain, sketch each of the following descriptions:a. The heavy parental chromosome and the products of the first replication after transfer to a 14N medium, assuming that the chromosome is one DNA double helix and that replication is semiconservative.b. Repeat part a, but now assume that replication is conservative.c. If the daughter chromosomes from the first division in 14N are spun in a cesium chloride density gradient and a single band is obtained, which of the possibilities in parts a and b can be ruled out? Reconsider the Meselson and Stahl experiment: What does it prove?arrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education