Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11.4, Problem 2COMQ
The proofreading function of DNA polymerase involves the recognition of a ________ and the removal of a short segment of DNA in the __________ direction.
a. missing base, 5′ to 3′
b. base pair mismatch, 5′ to 3′
c. missing base, 3′ to 5′
d. base pair mismatch, 3′ to 5′
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The proofreading function of DNA polymerase involves therecognition of a ________ and the removal of a short segment of DNA in the __________ direction.
a. missing base, 5′ to 3′
b. base pair mismatch, 5′ to 3′
c. missing base, 3′ to 5′
d. base pair mismatch, 3′ to 5′
DNA polymerase with 5'-3' as well as 3'-5' exonuclease and proofreading activity is
Select one:
a. Telomerase
b. DNA Pol-I
c. DNA pol-III
d. Primase
Which of the following best describes the process of DNA seqencing.
a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser.
b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments
c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR.
d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser
e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
Chapter 11 Solutions
Genetics: Analysis and Principles
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - Prob. 25CONQCh. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A cloned fragment of DNA was sequenced by using thedideoxy chain-termination method. A part of the autoradiogram of the sequencing gel is represented here.ddA ddG ddT ddCa. Deduce the nucleotide sequence of the DNAnucleotide chain synthesized from the primer. Label the5′ and 3′ ends.b. Deduce the nucleotide sequence of the DNAnucleotide chain used as the template strand. Label the5′ and 3′ ends.c. Write out the nucleotide sequence of the DNA doublehelix (label the 5′ and 3′ ends)arrow_forwardWhich repeating sequence below would you expect to find on the end of the longest DNA strand of a chromsome (select one)? A. 5'-TTTTTT-3' B. 5'-TTAGGG-3' C. 5'-CCCTAA-3' D. 5'-AAAAAA-3' E. 5'-GGATCC-3'arrow_forwardDifferent DNA polymerases play distinct roles in DNA replication and repair in both prokaryotic and eukaryotic cells. All known DNA polymerases synthesize DNA only in by the addition of the dNTPs to a performed primer strand of DNA. A. positive direction B. 3' to 5' direction C. 5' to 3' direction D. negative directionarrow_forward
- The use of dideoxynucleotide triphosphates in the Sanger method facilitates sequencing of polynucleotides. Why? A. Fragments are generated with the terminal ends corresponding to the complement of the DNA being sequenced. B. Incorporation of the specific dideoxynucleotides terminates polymerization of the newly synthesized DNA. C. Dideoxynucleotides are randomly incorporated to the growing polypeptide chain D. Both A and B E. All of thesearrow_forwardA researcher is interested in using the in vitro technique of bisulfite conversion to confirm the methylation status of a DNA sequence. A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction? i. Which bases are preferentially affected? B. What nucleotide change is expected immediately following sodium bisulfite treatment of the DNA? C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how many cytosines were unmethylated in the original DNA sequence? Briefly explain how you came to this conclusion. Before bisulfite treatment: After bisulfite treatment and a 30-cycle PCR reaction: 5' CGACGCGCGATTCATTCGATT 3' 5' TGACGCGTGATTTATTTGATT 3'arrow_forwardDuring the process of DNA extraction with organic solvents (indicate which one/s are correct) O A. DNA is finally dissolved in water and kept frozen for further use O B. DNA is dissolved by the organic solvents O C. A solution at high pH precipitates genomic DNA from the aqueous phase O D. DNA is kept in the aqueous phase whereas proteins and lipids are solubilized in organic solvents like phenol and chloroform O E. Salt and ethanol are used to precipitate DNA from the aqueous phasearrow_forward
- What does it mean to say thhat extension by DNA polymerase III proceed 5'---3'? A. The 5' end of a DNA polymerase molecule attaches to the 3' end of primase. B. DNA polymerase adds nucleotides to a growing strand, moving in the 5' to 3' direction. C. DNA polymerase seals nicks as it moves along a DNA strand toward the 3' end. D. DNA polymerase can only synthesize DNA at the 5' end of an existing strand of DNA.arrow_forwardHere is the cartoon representation and Ramachandran plot of a small DNA-binding protein, 80-residues in length. In its Ramachandran plot, 58 residues fall in the a region; 20 residues fall in the region; 2 residues fall in the L region. No residues fall in the disallowed region. The polypeptide termini are labelled. 11. Approximately what percentage of the protein is a-helix? A. 38% B. 42% C. 58% D. 72% 12. What percentage of the protein is B-sheet? A. 0% B. 25% C. 75% D. 100% 13. What percentage of the protein is regular structure? A. 3% B. 42% C. 58% D. 97% 14. What percentage of the protein is irregular structure? A. 0% B. 42% C. 75% D. 97% 15. How many domains are present? A. 1 B. 2 C. 3 D. 4 100 16. How many subunits are present? A. 1 B. 2 C. 3 D. 4arrow_forwardSanger sequencing (aka the chain termination) a. is a method for for determining the sequence of nucleotides in a piece of DNA of intrest. b. requires use of special ddNTPs (dideoxy nucleotides) that have special florecent lables (dyes) attached to them and also lack a 3' hydroxyl. c. requires fragments to be run through a tube containing a gel matrix where their fluorescent dyes are illuminated with a laser, which can be used to produce a chromatogram. d. all of the above are true e. none of the above are truearrow_forward
- a. Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each. 1. unwinds DNA 2. synthesizes new DNA strands 3. enzymatically catalyzes Quikchange 4. nucleotide source for new DNA strands 5. Energy source for reaction(s) 6. Repairs errors in base pair matching 7. Maintains pH and salt levels 8. Creates polymer chainsarrow_forwardWith regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy nucleotides are fluorescently labeled.b. The dideoxy nucleotides cannot be incorporated into a growingDNA strand.c. When incorporated into a DNA strand, the dideoxynucleotidesprevent further growth of the strand.d. The dideoxy sequencing method is used to determine the basesequence of DNA.e. The dideoxy sequencing method requires the use of primers.arrow_forwardDNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can verify “in the moment” that the nucleotide it is adding to the chain is the correct complementary base before moving on. This process is called Select one: a. mismatch repair b. transcription c. proofreading d. ligationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License