Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 10CONQ
As shown in Figure 11.5, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully.
A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.)
B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence.
C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
As shown, five DnaA boxes are found within the origin of replication in E. coli. Take a look at these five sequences carefully.
A. Are the sequences of the five DnaA boxes very similar to each other? (Hint: Remember that DNA is double-stranded; think about these sequences in the forward and reverse directions.)
B. What is the most common sequence for a DnaA box? In other words, what is the most common base in the first position, second position, and so on until the ninth position? The most common sequence is called the consensus sequence.
C. The E. coli chromosome is about 4.6 million bp long. Based on random chance, is it likely that the consensus sequence for a DnaA box occurs elsewhere in the E. coli chromosome? If so, why aren’t there multiple origins of replication in E. coli?
a) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.)
2. b) Is the top or bottom DNA strand the template strand?
Using the first and second base key below, predict the DNA sequence given by the SOLID
color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first
base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence.
A
First base
A
CCT
Second base
A CGT
BGY R
GBRY
RBG
R Y (G) B
Y
G)(R) GB )( R )( Y ) ( G) B
Chapter 11 Solutions
Genetics: Analysis and Principles
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - Prob. 25CONQCh. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forward
- The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.arrow_forwardDepurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: a) ...TAGT... ...ATCA... b) ...TACT... ...ATGA... c)...TAAT... ...ATTA... d) ...TAAT... ...AT_A... . e) ...TA_T... ...ATAA... f)...TATT... ...ATAA...arrow_forwardDepurination of purine bases results in an apurinic site. Assume a single depurination event occurs in the GC base pair of the sequence below and is not repaired. Then, if two rounds of replication occur, which of the following DNA sequences will exist after two rounds of replication? Remember that when DNA polymerases encounter an apurinic site, most often an A is incorporated into the newly synthesized strand. Assume this is true for the sequence below. ...TACT... ...ATGA... Question 7 Select one or more: ...TAGT... ...ATCA... 1. ...TACT... ...ATGA... 2. ...TAAT... ...ATTA... 3. ...TAAT... ...AT_A... 4. ...TA_T... ...ATAA... 5. ...TATT... ...ATAA...arrow_forward
- Draw the structure of a dideoxynucleotide that would be used for DNA sequencing, and explain why they result in chain termination. Write out the sequence of the first 20 nucleotides for the gene shown in the sequencing gel below (remember to start at the bottom of the gel and work upward, from smallest to largest fragments).arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forwardThe DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forward
- Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardthis is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.arrow_forwardIn a Sanger DNA sequencing reaction (dideoxy method) you use the primer 5′-GCATATA-3′ to sequence a DNA strand that starts with the sequence 3′-CGTATATCCCTACGTTGG-5′ (consider the strand about 100-nucleotide long). You try your sequencing reaction three times, but every time you make a mistake, as indicated below. What would be the outcome in each case? Justify your answers. (a) You forgot to add dCTP (b) You forgot to add ddCTP (c) Your primer is complementary to two regions in the DNA to be sequenced.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY