Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 26CONQ
A diagram of a linear chromosome is shown here. The end of each strand is labeled with A, B, C, or D. Which ends could not be replicated by DNA polymerase? Why not?
5′–A———————————————————B–3′
3′–C———————————————————D–5′
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Suppose that E. coli synthesizes DNA at a rate of 100,000 nucleotides per minute and takes 40 minutes to replicate its chromosome. (a) How many base pairs are present in the entire E. coli chromosome? (b) What is the physical length of the chromosome in its helical configuration—that is, what is the circumference of the chromosome if it were opened into a circle?
Here are two strands of DNA. —————————————— DNA polymerase→ —————————————————————— The one on the bottom is a template strand, and the one on the top is being synthesized by DNA polymerase in the direction shown by the arrow. Label the 5′ and 3′ ends of the top and bottom strands.
Consider the following segment of DNA, which is part of a linear chromosome:
LEFT 5’.…TGACTGACAGTC….3’
3’.…ACTGACTGTCAG….5’ RIGHT
During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. The replisome is approaching to a chromosomal end on the left. Considering this left chromosomal end, if without telomerase, the newly synthesized daughter DNA of ___________ will be shortened?
neither top or bottom strand
both top and bottom strands
the top strand
the bottom strand
Chapter 11 Solutions
Genetics: Analysis and Principles
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - Prob. 25CONQCh. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strandarrow_forwardThe diagram depicts one strand of DNA at the end of a chromosome. This strand has been replicated and produced two fragments, as shown below. Which of the two gaps that exist, labeled (a) and (b), can be filled by DNA polymerase? Hint: remember the directionality requirement for DNA polymerase. a) gap (a) b) gap (b) c) both gaps (a) and (b) d) neither gaps (a) nor (b)arrow_forwardConsider the following segment of DNA, which is part ofa much longer molecule constituting a chromosome:5′.…ATTCGTACGATCGACTGACTGACAGTC….3′3′.…TAAGCATGCTAGCTGACTGACTGTCAG….5′If the DNA polymerase starts replicating this segmentfrom the right,a. which will be the template for the leading strand?b. Draw the molecule when the DNA polymerase ishalfway along this segment.c. Draw the two complete daughter molecules.d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual modeof replication?arrow_forward
- The E. coli chromosome is 1.28 mm long. Under optimal conditions the chromosome is replicated in 40 minutes. (a) What is the distance traversed by one replication fork in 1 minute? (b) If replicating DNA is in the B form (10.4 base pairs per turn), how many nucleotides are incorporated in 1 minute in one replica- tion fork? (c) If cultured human cells (such as Hela cells) replicate 1.2 m of DNA during a 5-hour S phase and at a rate of fork movement one- tenth of that seen in E. coli, how many origins of replication must the cells contain? (d) What is the average distance, in kilobase pairs, between these origins?arrow_forwardWhich of the following statements about DNA polymerase I are true? 1) It requires both template DNA and a primer. 2) It can copy and join the ends of single-stranded circular DNA. 3) It uses only DNA as a template primer. 4) With respect to linear DNA, it copies only the 5′ end and then dissociates. a) Only statements 1 and 3 are true. b) Only statements 1 and 4 are true. c) Only statements 1, 2, and 4 are true. d) All of the listed statements are true.arrow_forwardMatch the definition on the left with the term on the right Tightly hypercolled DNA that is not in use Loosely colled DNA that is currently being used a) Chromatin b) Chromosomearrow_forward
- The statement “DNA replicates by a semiconservative mechanism” means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strandarrow_forward1.A Alleles are A) Dominant Genes B) Recessive Genes C) Two Version of the same genes D) alternate versions of the same gene. E) Sister Chromatids 1.B Which of the following processes takes place in the cytoplasm? - DNA replication - transcription -intron removal -translation -primary mRNA splicing 1.C For a DNA strand that is two nucleotides long, how many different sequences are possible? -2 -4 -8 -16 -64 1.D Which of the following is mismatched? A)physical expression of a trait - phenotype B)allele that masks the expression of an alternate allele - dominant C)identical alleles - heterozygous D)allele whose expression can be masked by an alternate allele recessive E)the specific alleles that an individual has - genotypearrow_forwarda) If you isolated DNA from the ear and the tail of the same mouse, would you expect the DNA, isolated form the two tissue types, to be the same? Why? (2) b) Provide one difference between DNA replication in eukaryotes and prokaryotes with regards to their origin(s) of replication. (1) For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). 14px E EY A Y BIVS Paragraph Arial ABC x² X2 ?次T Te 田田国王 用 图 +]arrow_forward
- A. In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication? B. In NOT more than 200 words, explain the special mechanism used to replicate chromosome ends?arrow_forwardConsider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand DNA molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. _____________ is the template strand for the synthesis of RNA? The sequence of the newly transcribed mRNA is _________________. Question 5 options: The top strand, 5'...GACUGUCAGUCA...3' The bottom strand, 5'...ACUCACUCUCAG...3' The top strand, 5'...UGACUGACAGUC...3' The bottom strand, 5'...GACUGUCAGUCA...3'arrow_forwardOnce in human cells, which of the following statements might best describe how COVID19 replicates? a) Manipulates DNA Polymerase III to create a leading strand replication of the RNA b) Manipulates DNA Polymerase III to create a lagging strand replication of the RNA c) Manipulates Reverse Transcriptase to transcribe RNA sense strand into DNA antisense strand then back d) Manipulates RNA Polymerase II to transcribe RNA sense strand into RNA antisense strand then back e) Manipulates RNA Polymerase III to transcribe ribosomal RNAs for replicationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY