Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 16CONQ
Describe the three important functions of DnaA protein.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Describe the three important of the protein DnaA.
List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
Chapter 11 Solutions
Genetics: Analysis and Principles
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - Prob. 25CONQCh. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardConsider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forwardWith this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?arrow_forward
- Give examples of the major structural motifs in DNA-binding proteins, and explain how they bind.arrow_forwardHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardGiven this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:arrow_forward
- What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and minor grooves of double-stranded DNA, and what part(s) is/are found in the DNA backbone? If a DNA-binding protein does not recognize a specific nucleotide sequence, do you expect that it binds tothe major groove, the minor groove, or the DNA backbone? Explain.arrow_forwardOutline the key structural features of the DNA double helix.arrow_forwardList three important structural motifs in DNA-binding proteinsarrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardDescribe the movement of the open complex along the DNA.arrow_forwardThe DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, and Non-template strand = 5' - ATGTCGTGAGTCAGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license