DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can verify “in the moment” that the nucleotide it is adding to the chain is the correct complementary base before moving on. This process is called Select one: a. mismatch repair b. transcription c. proofreading d. ligation

DNA synthesis has a very low error rate. One reason for this is that the DNA polymerase enzyme can verify “in the moment” that the nucleotide it is adding to the chain is the correct complementary base before moving on. This process is called Select one: a. mismatch repair b. transcription c. proofreading d. ligation

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Similar questions

Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
What specifically will happen if DNA polymerase is inaccurate during DNA synthesis? Explain how this inaccuracy might affect the organism.
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
What is/are the attributes that make nucleotide excision repair (NER) and base excision repair (BER) similar and/or different from each other? Select the correct response: The NER pathway is the only one that can remove DNA lesions in the strand regardless of their size which is followed by attaching the correct strand, then sealed by a DNA ligase. They both use the enzyme DNA glycosylases that recognizes the damaged DNA segments and proceed with repairing the faulty base in the strand. They differ NER only repairs purine bases while BER repairs pyrimidine bases. They both remove the damaged parts of the DNA where the BER pathway corrects only the identified damaged bases which are usually non-bulky lesions. The NER pathway, on the other hand, repairs the damage by removal of bulky DNA adducts which is a short-single stranded DNA segment. They both utilize the enzyme photolyase to reverse the damages created by the faulty section of the DNA. They both remove the damaged parts of the…
Match the activity below with the correct enzyme. (You won't use all the enzymes listed.) RNA acts as a template for DNA synthesis: RNA directs the cutting of an RNA molecule at a precise location: RNA directs the cutting of an DNA molecule at a precise location: options: a. Small Nuclear Ribonuclear Protein (SNRNP) b. telomerase c. primase d. helicase e. CRISPR/Cas9
Promotors are part of the DNA but enhancers are proteins that stick to the DNA True or false
Which of the following features is common to both DNA replication and RNA transcription? Both RNA and DNA polymerase form a sugar-phosphate bond between the 3' hydroxyl and the 5' phosphate. Both RNA and DNA polymerase require oligonucleotide priming. Both RNA and DNA polymerase incorporate deoxyribonucleotides into the growing sequence. Both RNA and DNA polymerase initiate at promoter sequences. Both RNA and DNA polymerase have extensive proofreading editing.
DNA polymerases have exonuclease activity that hydrolyzes DNA in the 3′ to 5′ direction. When an incorrect base is incorporated, it is removed by the exonuclease activity. true or false Endonuclease activity can remove an error in the middle of the DNA strand like DNA polymerase 1 that removes RNA primer. True or false DNA polymerases can recognize errors and engage exonuclease activity to fix the error on the spot. true or fale?
Which of the following statements regarding Nucleotide Excision Repair (NER) and Base Excision Repair (BER) is true? Only NER involves the action of DNA ligase to seal nicks in the DNA backbone. Both NER and BER involve DNA strand cleavage by an endonuclease. Both NER and BER can be activated by exposure to visible light. Only BER requires DNA polymerase. Both NER and BER involve the creation of an apyrimidinic (AP) site.
Indicate whether each of the following statements is true or false. If a statement is false, explain why it is false. A. The repair polymerase is the enzyme that proofreads the newly synthesized strands to ensure the accuracy of DNA replication. B. There is a single enzyme that degrades the RNA primers and lays down the corresponding DNA sequence behind it. C. DNA ligase is required to seal the sugar-phosphate backbone between all the DNA fragments on the lagging strand. D. The repair polymerase does not require the aid of the sliding clamp, because it is only synthesizing DNA over very short stretches. Answer the following questions about DNA replication. On a DNA strand that is being synthesized, which end is growing the 3' end, the 5' end, or both ends? Explain your answer. А. B. On a DNA strand that is being used as a template, where is the copying occurring relative to the replication origin-3' of the origin, 5', or both?
Which of the following best describes the process of DNA seqencing. a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser. b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR. d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bank