A researcher is interested in using the in vitro technique of bisulfite conversion to confirm the methylation status of a DNA sequence. A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction? i. Which bases are preferentially affected? B. What nucleotide change is expected immediately following sodium bisulfite treatment of the DNA? C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how many cytosines were unmethylated in the original DNA sequence? Briefly explain how you came to this conclusion. Before bisulfite treatment: After bisulfite treatment and a 30-cycle PCR reaction: 5' CGACGCGCGATTCATTCGATT 3' 5' TGACGCGTGATTTATTTGATT 3'
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
Step by step
Solved in 5 steps