A researcher is interested in using the in vitro technique of bisulfite conversion to confirm the methylation status of a DNA sequence. A. In vitro Sodium bisulfite treatment of DNA results in what type of chemical reaction? i. Which bases are preferentially affected? B. What nucleotide change is expected immediately following sodium bisulfite treatment of the DNA? C. You analyze the following DNA sequence before bisulfite treatment and after bisulfite treatment followed by a 30-cycle PCR reaction. Based on sequence comparison, how many cytosines were unmethylated in the original DNA sequence? Briefly explain how you came to this conclusion. Before bisulfite treatment: After bisulfite treatment and a 30-cycle PCR reaction: 5' CGACGCGCGATTCATTCGATT 3' 5' TGACGCGTGATTTATTTGATT 3'

Q: Classify each example as requiring either diffusion or bulk flow as a mechanism for molecular…

A: The transfer of any material from one location to another is referred to as transportation. In the…

Q: What variables are studied in Mortuary Archaeology?   A. Human Remains   B. Burials…

A: The objective of the question is to identify the variables that are studied in Mortuary Archaeology.

Q: What does it mean that a NYC population of Periplaneta americana (cockroach) is at Hardy-Weinberg…

A: Hardy-Weinberg equilibrium is a concept in population genetics that describes an idealized situation…

Q: esterol is the product of the to NADP+.

A: The conversion of 7-dehydrocholesterol to cholesterol involves a series of enzymatic mechanisms in…

Q: Carrier proteins that bind to substances to move them through the membrane and proteins that form…

A: Proteins are one of the integral groups of biomolecules. They have diverse functions such as…

Q: lon concentrations inside and outside of a typical mammalian cell are not the same. Which of the…

A: Ions are necessary for cellular activity. They participate in a wide range of crucial physiological…

Q: 2. What air pollutants contribute to acid rain? What acids do they form? (approx. 50 words) 3. What…

A: When dangerous materials or toxins are released into the environment, they can have a negative…

Q: If a cell that had two copies of each chromosome, but problems with the spindle caused the sister…

A: The question is asking about the outcome of a cell division process where there is a problem with…

Q: The MARCH-1 E3-ubiquitin ligase is expressed in B cells, dendritic cells, and macrophages. The…

A: Pathogens have evolved various mechanisms to evade the host immune system. One such mechanism is to…

Q: Describe effects of autoclave sterilization, refrigeration, freezing and pasteurization on microbial…

A: Microorganisms are usually so small that they cannot be seen by  the naked eyes. They are only seen…

Q: What is garbology? Define what this is and why it is important as a field of discipline. Minimum 2…

A: Garbology is the study of modern refuse and trash. As an academic discipline, it involves the…

Q: Which are the fittest individuals in a population? Are those that produce the largest number of…

A: One method of evolution is natural selection. More environment-adapted organisms have a higher…

Q: Who stole Mr. Marshall's blue stapler? A suspect was seen fleeing from Peck with Mr. Marshall's blue…

A: Examining genetic material taken from a living thing can provide meaningful insight. By making many…

Q: If a mutation is introduced into I-KBα that inhibits it phosphorylation by the IKK complex, this…

A: Mutation in I-KBα that inhibits its phosphorylation by the IKK complex can prevent the translocation…

Q: A human cell that has gone through the second division of meiosis will contain how many chromosomes

A: There are two types of cell divisions based on the distribution of genetic material (chromosome) in…

Q: 1) Summarize the main point of the study in two or three sentences.  (Make sure you use your own…

A: Summery of the paper:In this study the authors wanted to test the evolution of the the plant…

Q: The reduction potential of NADH is -320 mV. To which one of the following electron carriers could…

A: Redox reactions are chemical reactions involving oxidation and reduction. In such reactions…

Q: You find that the population inhabit in talus (broken rocks) are greyish. Another population live in…

A: Determining whether the two pika populations belong to the same species or are two different species…

Q: KDa 97.4 66.24 45.0 31.0 21.5 14.4 8-1 1-d s-2 For condition 1 - For condition 2 - For condition 3 -…

A: This question is asking about the dissemination of proteins within the supernatant and pellet…

Q: Sordaria fimicola is often used to demonstrate arrangement of colored ascospores within an ascus…

A: Sordaria fumicola is an ascomycetes fungus that is used to study the crossing over and recombination…

Q: Match the following molecules with their function in the Gq pathway. Phospholipase C IP3 DAG Protein…

A: The question revolves around the molecules involved in the Gq signaling pathway. This pathway is a…

Q: You have set up a fly cross between red-eyed male flies and white-eyed female flies. Several days…

A: The objective of the question is to determine the most likely genetic inheritance pattern for the…

Q: What are the different types of vertebra based on the shape of centrum?

A: Vertebrae are the individual bones that make up the vertebral column, also known as the spine or…

Q: Cell Shape Cell arrangement Coccus Spirillum Negative Strepto Single Positive Which of the following…

A: In order to identify a bacterial colony or singly present bacteria first of all some staining…

Q: 2. For the enzyme phosphofructokinase (PFK-1), a high concentration of AMP in the cell will •…

A: Phosphofructokinase I is the second enzyme that participates in glycolysis. It catalyses the…

Q: Based on the maximum body volume of organisms preserved in the fossil record, body volume (as…

A: The question is investigating the relationship between the evolution of life forms, as proven by the…

Q: Can you explain the various options and how did you come to the answer? How to determine when…

A: An acid is a molecule or ion capable of either donating a proton(Bronsted-Lowry acid) or forming a…

Q: What is biology ann school

A: Biology is the scientific study of life and living organisms. It encompasses a wide range of topics,…

Q: For the following sets of partial diploid bacteria, is the Z gene constitutive, inducible, or…

A: An inducible gene is a gene that can be turned on or off in response to specific signals or…

Q: transduction Would result in the false grouping of distantly related bacteria on a phylogeny:…

A: Bacteria are the microscopic, single-celled organisms that exist in millions, in the environment.…

Q: Do the egg and sperm each need to contain 46 chromosomes?

A: An organism's gametes are its reproductive cells. Another name for them is sex cells. Male and…

Q: The B-cell co-receptor, composed of CD19/CD21/CD81, is a receptor that binds to complement fragments…

A: A co-receptor is a type of cell surface receptor that functions by binding a signaling molecule in…

Q: Match the DNA replication model with its description and image.

A: There are 3 models of replication: 1. Conservative ReplicationDescription: The parental…

Q: Identify any ten latest medical terms used/published in journals/magazines/new papers and break them…

A: TermsMeaningReferencePCOS/ PCODPolycystic ovarian syndrome/ Poly-cystic ovarian…

Q: Determine the CFU/ml of the original culture in the image below. Write your value in scientific…

A: Serial dilution is a process by which a sample with an unknown concentration is used to calculate…

Q: In the graph below, a drug that was inhibitory would cause Membrane potential (mV) +40- 0- -40- -60-…

A: In the graph, you provided, a drug that was inhibitory would cause the membrane potential to be more…

Q: GLUTI deficiency syndrome (GLUTIDS) is a genetic disease caused by mutations in the GLUTI protein,…

A: Mutations are abrupt changes in the DNA sequence. Mutations in a gene, called SLC2A1 may give rise…

Q: с TTC TTTA TTG CTT CTC A H G T CTA CTG Phe Leu Leu с TCT TCC TCA TCG CCT ccc CCA Ser val ATA ACA ATG…

A: Any abrupt changes in the DNA  sequence is called mutation. It may or may not change the proteins…

Q: What is the best description for a Toad (Rhinella marina)

A: Rhinella marina, generally called as the cane toad. It is a large as well as robust amphibian…

Q: Discuss the parts of the digestive system of vertebrate and their functions

A: This question is asking about the different parts of the vertebrate digestive framework and their…

Q: When a woman is twenty weeks pregnant, the organs of what system are getting pushed upward in the…

A: Around the 20-week mark of pregnancy, which is considered the midpoint of a full-term pregnancy,…

Q: more variety amongst groups than between them. O True -False

A: Q3.Racial traits, including skin color, are accuratе indicators of gеographic origins because human…

Q: 9. A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…

A: Nucleotides are  the building blocks of nucleic acids that are DNA and RNA. It is made up of sugar…

Q: In a mouse mutant, all Norepinephrine (NE) synapses in the thalamus have a Protein Kinase A that…

A: The scenario presented involves a mouse mutant with a specific alteration in the Norepinephrine (NE)…

Q: Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E.…

A: The addition of IPTG to E. coli BL21(DE3) cells containing the pET-28a-OXA-M290 plasmid induces the…

Q: he LD50 of a certain substance is appreciably higher by inhalation than by ingestion. What…

A: The LD50 (lethal dose for 50% of the population) of a substance being significantly higher by…

Q: Dr. Lydia Villa-Komaroff... O developed methods to use PCR to analyze crime scenes, and was the…

A: Dr. Lydia Villa-Komaroff is a molecular biologist who is well-known for her contributions to the…

Q: mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 3 are not readily recognized…

A: The pre-mRNA given in the question is made up of exons (coding regions) and introns (non-coding…

Q: what are the bone found in toad (Rhinella marina) and its function

A: Bones are part of the skeletal system. Toad being a vertebrate has an endoskeleton made up of bones…

Q: out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com…

A: Transformation is a process in which the DNA is transformed or changed by taking up the DNA that is…

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.