Answered: Pfu Polymerase b.dNTPs c.Buffer…

Pfu Polymerase b.dNTPs c.Buffer Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each.

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 5RQ: The initial mechanism for repairing nucleotide errors in DNA is _____. a. mismatch repair b. DNA...

See similar textbooks

Related questions

Q: What are the etiologic factors, clinical findings, and management of excess and deficiency of the…

A: Hormones are the chemical messengers which are secreted from specialised endocrine glands directly…

Q: Which tenet of the cell theory is supported by the concepts of mitosis and meiosis? O Cells come…

A: In biology, cell theory is a scientific theory which was first formulated during mid-nineteenth…

Q: What is the neurobiology of major depression?

A: Major depression which is also called clinical depression is the state of mental disorder, in which…

Q: Which of the following will NOT happen either in prophase, metaphase, anaphase, telophase? All of…

A: A cell cycle is a series of events that takes place in a cell as it grows and divides.

Q: How does the level of spinal cord injury relate to expected functional losses and clinical…

A: Introduction The spinal cord is the main component of the CNS (Central Nervous System) which…

Q: it is possible that an alternative mechanism for generating germ cells could have evolved. consider…

A: Introduction When a mother cell divides into two or more daughter cells, this process is known as…

Q: How does mitosis result in daughter cells containing identical number and same DNA with its parent…

A: Mitosis is the process by which one cell divides into two genetically identical daughter cells. The…

Q: Describe how vesicles are cycled in the presynaptic terminal. Use a diagram if necessary

A: The science of cell structure and function is known as cell biology, and it is based on the idea…

Q: How is dopamine affected by chocolate and cocaine similar and different

A: Since you have asked multiple questions, we will slove the first question for you. If you want any…

Q: 38. Hydrocortisone is an anti-inflammatory drug that stabilizes lysosomal membranes. Explain how…

A: Introduction : Lysosomes are membrane-bound organelles and the area within the membrane is called…

Q: The pineapple plant that is growing here is through vegetative reproduction (asexual reproduction).…

A: Reproduction is the strategy by which biological organisms produce offspring. Depending on the…

Q: Proxies are used to a reconstruct past changes in climate b evaluate climate models OC. directly…

A: Introduction: Climate is the average weather over a longer length of time in a particular place. A…

Q: Under the fluorescence microscope, what is the structured stained in red? O centrioles O sister…

A: Fluorescence microscopy is a technique that is based on using Fluorescence to observe specimens.…

Q: uestions: Storage 1 nd aNgabe

A: The kingdom plantar or plant kingdom includes all eukaryotic, chlorophyll-containing, autotrophic…

Q: How can bright field and dark field optical microscopy be used in characterizing materials? What…

A: Most of the cells are too small to be detected by unaided human eye. The development of microscope…

Q: medical/biomedical model defines "health" as total wellbeing mind, body, spirit the absence of…

A: A medical or Biomedical model of health is the most accepted model of health in western countries.…

Q: QUESTION 7 You are working on an undergraduate project, studying an insect species. A recent study…

A: Introduction : A selection coefficient in population genetics is a measurement of variations in…

Q: Lic ns ue Qu Que HO CH₂OH OH H H₂N- O CH₂ CH₂ CH₂-N(CH₂ CH₂ CH₂CH-CH₂ 0-810 O OH · ¡ 6 6 6 6 6 6 6 -…

A: Amino acids are organic compounds that contain both amino and carboxylic groups. Carbohydrates are…

Q: 1. list all the similarities between DNA and chromosome

A: The nucleic acids found in the cells are DNA and RNA. DNA resides in the nucleus while RNA can be…

Q: sea urchins

A: Embryonic developmental stages: There are 4 stages of embryonic development which include morula,…

Q: What does translucent spot mean with regards to lipid?

A: Fats and lipids are important biomolecules. These are high-energy molecules. Fats and lipids are…

Q: In a double blind clinical trial for a drug neither the subjects nor the researcher knows who is in…

A: Introduction In a double-blind trial, neither the volunteers nor the researchers are aware of who…

Q: A few finches from the mainland get caught in a strong wind and end up colonizing a new island.…

A: Hardy Weinberg (HWE) principle – In HWE the genotype frequencies and allele frequencies of a…

Q: Calculate the average number of nucleotide pairs pero micrometer of DNA double helix according to…

A: Watson and Crick's model of DNA James D. Watson and Francis H. Crick suggested the…

Q: if 20 skin cells enter G2 phase, how many cells will be observed at the end of metaphase? O 10 030 O…

A: The orderly sequence of events by which a cell duplicates its DNA synthesizes its other components…

Q: Which of the following modifications of the Epithelial Growth Factor Receptor (EGFR) would be…

A: Epidermal growth factor receptor is a transmembrane protein that spans the length of the cell…

Q: 6. Do all outer cell membrane surface receptors bind G-proteins? 7. What is an example of a hormone…

A: Cellular receptors are proteins either inside a cell or on its surface, which receive a signal.

Q: Which of the following is a function of lipids? (Select all that apply.) Question 8 options:…

A: Lipids are biomolecules that are insoluble in water but soluble in organic solvents. They include a…

Q: What sorts of laws (if any) do you think should be passed regarding the confidentiality of genetic…

A: Introduction Genetics is the study of the transfer of certain traits (eye color, hair color) and…

Q: quick burst of energy?

A: Note : As in the questions mentioned above, the answers for 2,4,5,6,7 are already solved and there…

Q: 3. The pedigree below was obtained for a rare kidney disease. a) Deduce the inheritance of this…

A: Introduction Genetic variation distribution in families is characterised by inheritance patterns.…

Q: Which of the following marks an important event during telophase? Onuclear envelope starts to…

A: Cell division is the process of dividing parent cell into its daughter cell . This division are of…

Q: For most cell types, serum must be added to the media to get cells to grow and proliferate in…

A: In humams serum is the plasma without clotting factors. Which means that plasma contains antibodies,…

Q: Which expenmental outcomes collactively support the conclusion that an embryonio cell has a…

A: Introduction Embryonic stem cells come from initial stage of embryos. Generally embryonic stem cells…

Q: If nuclear DNA replicates during the S (synthesis) phase of the cell cycle, when does mitochondrial…

A: A cell cycle is the sequence of events that occur in a cell as it grows and divides.

Q: Describe the action potential in terms of the different functional states of the voltage- gated Na+…

A: Introduction Action potential is the short term change in the electric…

Q: How does the cell membrane help maintain water content homeostasis?

A: Introduction To attain balance, the body is continually attempting to control its internal…

Q: How do we know that cancer development requires morethan one mutation?

A: Cancer is disease releted to cell. In cancer disease abnormal cells divide uncontrollably and…

Q: What clinical and laboratory findings would lead to a diagnosis of liver cirrhosis?

A: Acute or chronic liver damage which can be caused by various liver diseases like hepatitis or due to…

Q: G1 phase cat cells will have 19 pairs of chromosomes. In a cat cell in metaphase of mitosis .. A.…

A: Introduction The process of reproduction known as cell division requires all cells to make a…

Q: The pattern of growth of any organism is controlled by hormones homeostasis genes anabolic and…

A: Introduction :- Any self-regulating process, such as homeostasis, helps an organism retain stability…

Q: The tickle response can also trigger escape movements, increased heart rate and tears. What type of…

A: Introduction The neuron, a specialised cell created to send information to other nerve cells,…

Q: How does plant cytokinesis differ from animal cytokinesis? Opposing forces distribute the cell…

A: First of all, we need to discuss about what is cytokinesis in plant and animal cell. So, the…

Q: How are the dopamine D1 and D2 receptors related to positive and negative symptoms of schizophrenia?

A: It is well known that dopamine (DA) plays an important role in the pathophysiology of schizophrenia.…

Q: Hypothetically speaking, what will be the form of chromosomes if it will condense after S phase? O…

A: Cell division is a phenomenon in which parent cell splits to form new cell . It comprises of:- I )…

Q: What is phase contrast? Give examples of phase contrast in optical microscopy

A: Microscopy is the technique for visualisation of ultra-small objects such as cells or even smaller…

Q: Epigenetics is a HUGE new field in understanding health factors that are transmitted from generation…

A: It is the branch of science which deals with the study of how environment and behaviours will…

Q: What causes regular cocaine users to chose that "initial high"?

A: Cocaine, a highly addictive stimulant narcotic, is derived from the leaves of the South American…

Q: Is the Triple-Sugar Iron Agar (TSIA) a complex or defined medium? Explain based on its composition.…

A: Introduction A solid or liquid substrate that can be used to grow cells or organ explants; a medium…

Q: MACROMOLECULE/LARGE Mol 1. CARBOHYDRATE 2. PROTEINS 3. NUCLEIC ACIDS BOND CLASSIFICATION/STRUCTURE…

A: Introduction Macromolecules are the larger molecules that are usually made from the simpler or…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

a. Pfu Polymerase

b.dNTPs

c.Buffer

Match each component above to the correct function(s) listed below. Write your selection(s) for each component. You may have more than one answer for each.

1. unwinds DNA

2. synthesizes new DNA strands

3. enzymatically catalyzes Quikchange

4. nucleotide source for new DNA strands

5. Energy source for reaction(s)

6. Repairs errors in base pair matching

7. Maintains pH and salt levels

8. Creates polymer chains

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 introduction

VIEW

Step 2 answer

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Match the substance to it's function. v Prevents supercoiling/Overwinding of the DNA A. Nucleosomes v Unwinds and separates the double stranded DNA B. Toposiomerase v Adds a short piece of complementary RNA nucleotides C. Ribosome v Copies DNA and adds complimentary DNA nucleotides D. Nuclease v Prevents DNA strands from connecting E. RNA polymerase v Links together short segments of DNA F. Helicase v Found only in the lagging strand G. DNA Polymerase v What chromosomes are made of H. DNA and Proteins v The proteins found in chromosomes I. Codon v DNA wrapped around proteins J. Okazaki Fragments Responsible for making mRNA K. Anticodon v The site of translation L. DNA Ligase M. Histones v Cuts DNA for mutation repair N. Primase v A triplet of nucleotides on MRNA O. Single Strand Binding Proteins v A triplet of nucleotides on tRNA
Match the enzymes provided from (1-4) in the list of choices with their matching function (A-D) during DNA replication. A. Disrupts hydrogen bonds between DNA bases B. Can only add nucleotides to an existing 3 OH end C. Can't add nucleotides to a chain, but can make covalent bonds D. Actually a specialized form of RNA polymerase select 1. DNA polymerase select 2. Primase select 3. Ligase select v 4. Helicase
Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication Complement of each strand ii. Transcribe the complement strand of DNA into an mRNA strand Translate the mRNA strand into an Amino Acid strand iii. a. ATGGACGTATAGATGACAGGTAGATGTTTCAGGGGGATTTATCGATAG b. ATGGCCATTGAGTGTCAAAAGTCTCAATGA First base U UUU UUC UUA UUG CUU CUC C CUA CUG G U -phenylalanine (Phe) -leucine (Leu) GUU GUC GUA GUG leucine (Leu) AUU AUC isoleucine (lle) Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Second base ACU ACC AUA ACA AUG methionine (Met) (start) ACG -valine (Val) UCU UCC UCA UCG CCU CCC CCA CCG GCU GCC GCA GCG C -serine (Ser) -proline (Pro) -threonine (Thr) -alanine (Ala) UAU UAC UAA stop UAG stop CAU CAC CAA CAG AAU AAC AAA AAG A -tyrosine (Tyr) GAU GAC GAA GAG - histidine (His) -glutamine (Gln) - asparagine (Asn) -lysine (Lys) -aspartic acid (Asp) -glutamic acid (Glu) CGU CGC CGA CGG AGU AGC AGA AGG G -cysteine…
Match each enzyme name in the left column with the correct descriptive phrase in the right column. a. Topoisomerase II b. DNA ligase c. DNA polymerase y d. Reverse transcriptase i. Catalyzes most nucleotide incorporations in bacterial DNA replication ii. Cleaves RNA in a DNA-RNA hybrid molecule e. DNA polymerase I f. DNA polymerase II iii. Uses a tRNA primer in synthesis of retroviral DNA iv. Acts through an adenylylated DNA inter- mediate v. Catalyzes formation of a double-strand DNA break vi. Catalyzes mitochondrial DNA replication
#3 under Identify the Structures is what? A. phosphate polymerase complex B. DNA polymerase complex C. deoxyribose sugar polymerase complex D. nitrogen base polymerase complex
How would nucleotide excision repair be affected if one of the followingproteins was missing? Describe the condition of the DNAif the repair was attempted in the absence of the protein.A. UvrAB. UvrCC. UvrDD. DNA polymerase
Enzyme function is critically important for the proper replication of DNA. Predict the consequence of a loss of function for each of the following enzymes. a. DNA gyrase b. DNA polymerase III c. DNA ligase d. DNA polymerase I
Which statement below is true? Select one: a. Okazaki fragments are produced in eukaryotic DNA replication but not in prokaryotic DNA replication. b. In both eukaryotes and prokaryotes, the template strand of DNA is read in the template’s 3’ to 5’ direction, while the new strand DNA is synthesized in new strand’s 5’ to 3’ direction. c. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is random. d. In eukaryotes, synthesis of the new DNA strand is from 5’ to 3’, whereas in prokaryotes it is from 3’ to 5’. e. In eukaryotes, synthesis of the new DNA strand is from 3’ to 5’, whereas in prokaryotes it is from 5’ to 3’.
I. Unwinding of DNA and formation of replication fork II. Proofreading of strands and replacing any errors during the synthesis. III. Synthesizing a new strand that matches the template, by extending the primer via the addition of he nucleotides to the 3' end. IV. Formation of semiconservative strands Which stage use/s DNA polymerase? A. I and II B. II and III C. Il only D. Ill only Which of the following sequence shows the correct process of DNA replication? A. I, I, III, IV B. I, II, IV, III C. I, III, IV, II D. I, III. II, IV
Pyrimidine dimers in DNA may be repaired by in E. coli cells. (select all correct answers) Select one or more: O a. photolyase O b. nucleotide excision repair O c. mis-match repair O d. methyl-transferase
RNA primers are necessary in DNA synthesis because OA. primers mark the sites where helicase has to unwind the DNA. OB. the DNA polymerase enzyme can catalyze the addition of deoxyribonucleotides only onto the 3' (-OH) end of an existing strand. O C. RNA primase is the first enzyme in the replication complex. D. they are the source of nucleotides for DNA polymerases. 00 O E. DNA polymerase is unable to initiate replication without an origin. 5 p
DNA replication requires ________ . a. DNA polymerase c. primers b. nucleotides d. all are required