Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 5EQ
The technique of dideoxy sequencing of DNA is described in Chapter 21. The technique relies on the use of dideoxyribonucleotides (shown in Figures 21.10 and 21.11). A dideoxyribonucleotide has a hydrogen atom attached to the 3′carbon atom instead of a hydroxyl
group. When a dideoxyribonucleotide is incorporated into a newly made strand, the strand cannot grow any longer. Explain why.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A DNA strand was sequenced using the Sanger method
(https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction
tube contained the DNA strand, fluorescently labelled
dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green,
ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA
polymerase, or its Klenow fragment. Synthesis of DNA is allowed to
proceed, and the results are shown on the right:
15
14
13
12
11
10
(a) What is the sequence of the copy and the template strands?
(b) If the template strand were in the 5'-3' direction, what will be
the sequence of the DNA copy?
Nucleotide Length
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA?
Template : P- AGACTTG-OH
New strand :
The technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the use of dideoxyribonucleotides(shown in Figures 20.5 and 20.16). A dideoxyribonucleotidehas a hydrogen atom attached to the 3′-carbon atom insteadof an –OH group. When a dideoxyribonucleotide is incorporatedinto a newly made strand, the strand cannot grow any longer.Explain why.
Chapter 11 Solutions
Genetics: Analysis and Principles
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - Prob. 25CONQCh. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?arrow_forwardIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward
- Like DNA, RNA follows base-pairing rules. Experiment to find which RNA nucleotide on the right side of the Gizmo will successfully pair with the thymine at the top of the template strand of DNA. (NOTE: The DNA on the right side is the template strand.) Which RNA base bonded with the thymine?arrow_forwardIf a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAG Use the editor to format your answerarrow_forwardDefine the reason why when a dideoxyribonucleotide is incorporated into a newly made strand the the strand cannot grow any longer.arrow_forward
- The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardThe following fragment of DNA is from the template strand. First determine the amino acids of the protein encoded by this sequence by using the table at the end of this document. Then give the altered amino acid sequence of the proteins that will be found in each of the following mutations: 3’ – TAC AAG GCT CTA TTT GCC ACA ATC – 5’ The nucleotides are numbered 1-24 from left to right. Mutant 1: A transition at nucleotide 9 Mutant 2: A transition at nucleotide 11 Mutant 3: A T to A transversion at nucleotide 15 Mutant 4: A one-nucleotide deletion at nucleotide 7 Mutant 5: A transition at nucleotide 13 Mutant 6: An addition of GGA after nucleotide 6arrow_forwardAn exonuclease is an enzyme that sequentially cleaves nucleotides from the end of a polynucleotide strand. Snake venom phosphodiesterase, which hydrolyzes nucleotides from the 3′ end of any oligonucleotidewith a free 3′-hydroxyl group, cleaves between the 3′ hydroxyl of the ribose or deoxyribose and the phosphoryl group of the next nucleotide. It acts on single-stranded DNA or RNA and has no base specificity. This enzyme was used in sequence determination experiments before the development of modern nucleic acid sequencing techniques. What are theproducts of partial digestion by snake venom phosphodiesterase of an oligonucleotide with the sequence (5′)GCGCCAUUGC(3′)—OH?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license