Concept explainers
Sometimes DNA polymerase makes a mistake, and the wrong
Want to see the full answer?
Check out a sample textbook solutionChapter 11 Solutions
Genetics: Analysis and Principles
- The two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure (Figure 1) shows the thymine-adenine bond. Each charge shown is ±e, and the H−N distance is 0.110 nm . Calculate the net force that thymine exerts on adenine. To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O−H−N and the N−H−N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O−H−N set, the O− exerts a force on both the H+ and the N−, and likewise along the N−H−N set. Express your answer in newtons. Is the net force attractive or repulsive?arrow_forwardIn the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forward
- As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardDNA molecules of different sizes are often separated with the use of a technique called electrophoresis . With this technique, DNA molecules are placed in a gel, an electrical current is applied to the gel, and the DNA molecules migrate toward the positive (+) pole of the current. What aspect of its structure causes a DNA molecule to migrate toward the positive pole?arrow_forwardDNA polymerase IIl sometimes makes a mistake during replication and builds the wrong nucleotide into the newly synthesized DNA strand. Most of these mistakes are corrected by the proof reading function of DNA polymerase III. Some mistakes are missed and need to be repaired. In terms of purines and pyrimidines, there are two possible types of mistakes. The first one is called a transition. A transition is where the incorrect pyrimidine is built into the growing strand instead of the correct pyrimidine. The same applies for the purines. When a purine is built into the new strand instead of a pyrimidine, or vice versa, it is called a transversion. If a transition or transversion is not detected by DNA polymerase III, the resulting mutation permanently changes the DNA sequence. Both of these types of mutations are rare. However, 1. transition mutations are more frequent than transversion mutations. a. Based on your knowledge of the structure of purines and pyrimidines, propose an…arrow_forward
- DNA polymerase IIl sometimes makes a mistake during replication and builds the wrong nucleotide into the newly synthesized DNA strand. Most of these mistakes are corrected by the proof reading function of DNA polymerase III. Some mistakes are missed and need to be repaired. In terms of purines and pyrimidines, there are two possible types of mistakes. The first one is called a transition. A transition is where the incorrect pyrimidine is built into the growing strand instead of the correct pyrimidine. The same applies for the purines. When a purine is built into the new strand instead of a pyrimidine, or vice versa, it is called a transversion. If a transition or transversion is not detected by DNA polymerase II, the resulting mutation permanently changes the DNA sequence. Both of these types of mutations are rare. However, transition mutations are more frequent than transversion mutations. 1. a. Based on your knowledge of the structure of purines and pyrimidines, propose an…arrow_forwardGiven this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxxarrow_forwardDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & IIIarrow_forward
- The DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’ and Non-template strand = 5' - ATG-TCG-TGA-GTC-AGT - 3' . If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed and the chain arrangement of the amino acids produced by this mutation? 4th sequence (from the left) should be = TCG right?arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardMake the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA? Template : P- AGACTTG-OH New strand :arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education