Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 6EQ
Gierer and Schramm exposed plant tissue to purified RNA from tobacco mosaic virus, and the plants developed the same types of lesions as if they had been exposed to the virus itself. What would be the results if the RNA was treated with DNase, RNase, or protease prior to its exposure to the plant tissue?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A patient has arrived at the doctor complaining of acute respiratory symptoms (cough, runny nose, fever). The patient explains to the doctor that he was at a concert the night before and shared a water bottle with a friend who had similar symptoms. The doctor tells the patient that he has a virus. a.) What form of replication do you think this virus does use? How do you know? b.) Can the doctor prescribe an antibiotic for this patient? Explain.
Assume you isolate a single stranded (+) RNA virus. When you examine the proteins in the virus, you find that it does NOT contain replicase enzymes within its capsid. Which of the following is true?
This virus must have a gene that encodes replicase.
This virus will not be able to enter a host cell.
Its genome cannot be translated (the process of translation) by the host cell ribosomes.
A DNA copy of the viral genome has to be made before viral genes are expressed.
This virus must lack surface antigens.
A patient has arrived at the doctor complaining of acute respiratory symptoms (cough, runny nose, fever). The patient explains to the doctor that he was at a concert the night before and shared a water bottle with a friend who had similar symptoms. The doctor tells the patient that he has a virus. a.) Can the doctor prescribe an antibiotic for this patient? Explain. b.) What form of replication do you think this virus does use? How do you know?
explain in details
Chapter 9 Solutions
Genetics: Analysis and Principles
Ch. 9.1 - In the experiment of Avery, McLeod, and McCarty,...Ch. 9.1 - In the Hershey and Chase experiment involving T2...Ch. 9.2 - Going from simple to complex, which of the...Ch. 9.3 - Which of the following could be the components of...Ch. 9.3 - Prob. 2COMQCh. 9.4 - Prob. 1COMQCh. 9.5 - Prob. 1COMQCh. 9.5 - Prob. 2COMQCh. 9.6 - 1. Which of the following is not a feature of the...Ch. 9.6 - 2. A groove in the DNA refers to
a. the...
Ch. 9.6 - Prob. 3COMQCh. 9.7 - 1. A double-stranded region of RNA
a. forms a...Ch. 9 - 1. What is the meaning of the term genetic...Ch. 9 - Prob. 2CONQCh. 9 - 3. Look up the meaning of the word transformation...Ch. 9 - Prob. 4CONQCh. 9 - 5. Draw the structures of guanine, guanosine, and...Ch. 9 - Prob. 6CONQCh. 9 - 7. Describe how bases interact with each other in...Ch. 9 - Prob. 8CONQCh. 9 - 9. What is meant by the term DNA sequence?
Ch. 9 - Make a side-by-side drawing of two DNA helices:...Ch. 9 - 11. Discuss the differences in the structural...Ch. 9 - What part(s) of a nucleotide (namely, phosphate,...Ch. 9 - List the structural differences between DNA and...Ch. 9 - Draw the structure of deoxyribose and number the...Ch. 9 - Write a sequence of an RNA molecule that could...Ch. 9 - Compare the structural features of a...Ch. 9 - Which of the following DNA double helices would be...Ch. 9 - What structural feature allows DNA to store...Ch. 9 - Prob. 19CONQCh. 9 - Prob. 20CONQCh. 9 - Prob. 21CONQCh. 9 - 22. On further analysis of the DNA described in...Ch. 9 - Prob. 23CONQCh. 9 - Prob. 24CONQCh. 9 - In what ways are the structures of an helix in a...Ch. 9 - Prob. 26CONQCh. 9 - Prob. 27CONQCh. 9 - 28. What chemical group (phosphate group, hydroxyl...Ch. 9 - The base composition of an RNA virus was analyzed...Ch. 9 - Prob. 30CONQCh. 9 - Prob. 31CONQCh. 9 - Prob. 32CONQCh. 9 - Prob. 33CONQCh. 9 - As described in Chapter 15, the methylation of...Ch. 9 - 35. An RNA molecule has the following sequence:...Ch. 9 - 1. Genetic material acts as a blueprint for an...Ch. 9 - 2. With regard to the experiment described in...Ch. 9 - Prob. 3EQCh. 9 - Prob. 4EQCh. 9 - 5. With regard to Chargaff’s experiment described...Ch. 9 - 6. Gierer and Schramm exposed plant tissue to...Ch. 9 - 1. Try to propose structures for a genetic...Ch. 9 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The table below shows the properties of the genomes of three different viruses. The data were obtained as follows: Nuclease sensitivity was measured by the ability of deoxyribonuclease (DNase) or ribonuclease (RNase) to destroy the genome (a “+" means sensitivity). The ability of the genome to act as mRNA was tested by incubating it in a cell-free system. If amino acids were incorporated into protein, the data are shown as a Finally, the virus particles were tested for the presence of a virion polymerase. If an enzyme was present, the data show whether it could polymerize deoxynucleotide triphosphates (DNTPS) or nucleoside triphosphates (NTPS). "+. Genome Properties Nuclease Virion Can Genome Sensitivity? Polymerase? Be an mRNA? Virus DNase RNase With With DNTPS NTPS #1 - - #2 - - #3 For each virus, indicate the strategy of the genome, using the Baltimore classification. What is the nature of the product of the virion polymerase when present? + + + + + +arrow_forwardThe question is: A patient has arrived at the doctor complaining of acute respiratory symptoms (cough, runny nose, fever). The patient explains to the doctor that he was at a concert the night before and shared a water bottle with a friend who had similar symptoms. The doctor tells the patient that he has a virus. a.) What form of replication do you think this virus does use? How do you know? b.) Can the doctor prescribe an antibiotic for this patient? Explain.arrow_forwardThere are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forward
- what’s a plasmid?arrow_forwardAfter a positive strand RNA virus ( Such as Coronaviruses) enters the host cell, the RNA is translated by ribosomes to create proteins associated with the virus (Such as, for example, the surface antigens like E and Spike proteins). How then, would the genetic material itself be replicated to be incorporated into the new viruses?.arrow_forwarda) Where is the F plasmid located in an Hfr cell? Where is the F plasmid located in an F+ cell? b)arrow_forward
- A scientist isolates the DNA genome from a virus. She attempts to carry out a melting analysis but finds only 10% hypochromicity. (a) Suggest an explanation for the low value. (b) Why do you think she finds this much?arrow_forwardA particular animal virus requires the use of DNA polymerase from its host, since it does not possess its own DNA polymerase enzyme. Which of the following assumptions in A-D would likely be correct regarding this virus? A) O This virus could not be a retrovirus type. B) OIt could be a (-) ss RNA virus. C) O It could be a (+) ss RNA virus. D) O The vVirus life cycle very likely includes going to the host cell nucleus. E) O All ofA-D are correct assumptions.arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- Some DNA vaccines use a brief and small electrical shock to get DNA in plasmids into cells. What advantage would there be in using DNA vaccines that consist of plasmids instead of just pieces of double-stranded DNA? The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein? Why not just inject the double-stranded cDNA that codes for the spike protein of the virus? What additional step or steps would you need to use to get the human muscle cells to produce the spike protein if the cDNA was injected to serve as the virus?arrow_forward1). Which nucleotides make up a DNA strand? 2). Which nucleotides make up an RNA strand? 3). Explain a substitution mutation 4) Explain a deletion mutation 5). Explain an insertion mutation 6). What was the guiding question from the lab? 7). Explain to me how you learned that mutations affect the function of an organism.arrow_forwardIf a virus particle contained double-stranded B-DNA of 500,000 base pairs, what would be the radius of the DNA fiber before packing into the virus?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License