Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 1QSDC
Try to propose structures for a genetic material that are substantially different from the double helix. Remember that the genetic material must have a way to store information and a way to be faithfully replicated.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Using the figure below identify:
What is a function of introns and exons?
What is a role of mobile DNA elements?
What is a meaning of simple-sequence DNA?
The complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.
Let’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in details
Chapter 9 Solutions
Genetics: Analysis and Principles
Ch. 9.1 - In the experiment of Avery, McLeod, and McCarty,...Ch. 9.1 - In the Hershey and Chase experiment involving T2...Ch. 9.2 - Going from simple to complex, which of the...Ch. 9.3 - Which of the following could be the components of...Ch. 9.3 - Prob. 2COMQCh. 9.4 - Prob. 1COMQCh. 9.5 - Prob. 1COMQCh. 9.5 - Prob. 2COMQCh. 9.6 - 1. Which of the following is not a feature of the...Ch. 9.6 - 2. A groove in the DNA refers to
a. the...
Ch. 9.6 - Prob. 3COMQCh. 9.7 - 1. A double-stranded region of RNA
a. forms a...Ch. 9 - 1. What is the meaning of the term genetic...Ch. 9 - Prob. 2CONQCh. 9 - 3. Look up the meaning of the word transformation...Ch. 9 - Prob. 4CONQCh. 9 - 5. Draw the structures of guanine, guanosine, and...Ch. 9 - Prob. 6CONQCh. 9 - 7. Describe how bases interact with each other in...Ch. 9 - Prob. 8CONQCh. 9 - 9. What is meant by the term DNA sequence?
Ch. 9 - Make a side-by-side drawing of two DNA helices:...Ch. 9 - 11. Discuss the differences in the structural...Ch. 9 - What part(s) of a nucleotide (namely, phosphate,...Ch. 9 - List the structural differences between DNA and...Ch. 9 - Draw the structure of deoxyribose and number the...Ch. 9 - Write a sequence of an RNA molecule that could...Ch. 9 - Compare the structural features of a...Ch. 9 - Which of the following DNA double helices would be...Ch. 9 - What structural feature allows DNA to store...Ch. 9 - Prob. 19CONQCh. 9 - Prob. 20CONQCh. 9 - Prob. 21CONQCh. 9 - 22. On further analysis of the DNA described in...Ch. 9 - Prob. 23CONQCh. 9 - Prob. 24CONQCh. 9 - In what ways are the structures of an helix in a...Ch. 9 - Prob. 26CONQCh. 9 - Prob. 27CONQCh. 9 - 28. What chemical group (phosphate group, hydroxyl...Ch. 9 - The base composition of an RNA virus was analyzed...Ch. 9 - Prob. 30CONQCh. 9 - Prob. 31CONQCh. 9 - Prob. 32CONQCh. 9 - Prob. 33CONQCh. 9 - As described in Chapter 15, the methylation of...Ch. 9 - 35. An RNA molecule has the following sequence:...Ch. 9 - 1. Genetic material acts as a blueprint for an...Ch. 9 - 2. With regard to the experiment described in...Ch. 9 - Prob. 3EQCh. 9 - Prob. 4EQCh. 9 - 5. With regard to Chargaff’s experiment described...Ch. 9 - 6. Gierer and Schramm exposed plant tissue to...Ch. 9 - 1. Try to propose structures for a genetic...Ch. 9 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequences of several short single-stranded DNA molecules are shown below. Imagine each sequence as a typical double-stranded DNA molecule, with antiparallel strands held together by Watson-Crick base- pairs between the complementary bases. Which of these double-stranded molecules would have the highest melting temperature (Tm)? 5' ACTGAGTCTCTGACTAGTCT 3' 5' ACTTAGTCTATGACTAGTCT 3' 5' ACTTAATCTATGAATAGTCT 3' 5' ACTGCGTCTCCGACTAGTCT 3' 5' ACTGCGTCTCCGACGAGCCT 3'arrow_forwardSingle-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.arrow_forwardThe following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?arrow_forward
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardWrite out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotidearrow_forwardWe have talked about several examples of cis-acting elements that have dyad symmetry (inverted repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give one example of one that functions at the DNA level and briefly explain why the sequence requires dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of the element. Edit View Incort Format Tools Tabloarrow_forward
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into apolypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams,colours and annotations to describe how the DNA strand will be synthesized into afunctional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in theDNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function usinghaemoglobin as an example (8).5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’arrow_forwarddetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function using haemoglobin as an examplearrow_forward
- Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardThe sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…arrow_forwardWhich of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY: 1. nitrogenous bases of opposite strands are paired through covalent bonds 2. base pairs are stacked 3.4 A (0.34 nm) apart 3. the two strands of one double helix are complementary 4. two long polynucleotide chains 5. there are 20 base pairs per each turn of a double helix 6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand 7. bases face outside of the double helix 8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds 9. here are A-T and G-C pairs in DNA double helix 10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds 11. the two strands of one helix are antiparallel 12.double helix 13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA I tried 2,3,4,9,10,11,12,13 together and got it…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license