Genetics: Analysis and Principles
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 9, Problem 34CONQ

As described in Chapter 15, the methylation of cytosine bases can have an important effect on gene expression. For example, the methylation of cytosines may inhibit the transcription of genes. A methylated cytosine base has the following structure:

Chapter 9, Problem 34CONQ, As described in Chapter 15, the methylation of cytosine bases can have an important effect on gene

Would you expect the methylation of cytosine to affect the hydrogen bonding between cytosine and guanine in a DNA double helix? Why or why not? (Hint: See Figure 9.12 for help.) Look back at question 2 in More Genetic TIPS and speculate as to how methylation could affect gene expression.

Blurred answer
Students have asked these similar questions
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which prevent ions from moving across cell membranes. Normally there are channel proteins that allow passage of the ions, but in patients with one kind of CF these proteins seem odd. Closer examination shows that these proteins display the correct amino acid sequence. However, they fail to do their job. A) Given that the primary structure of the protein is correct, what can you infer about the DNA sequence for the gene coding this protein on this patient, is there a mutation? Explain. B) Why is the primary structure insufficient to guarantee the proper function of the protein?
As you should recall, DNA, when not being actively transcribed, has a double helical structure.  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template   strand?  ______________________________ Q:  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:      ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:  ________--________--________--________--________--________--________--________

Chapter 9 Solutions

Genetics: Analysis and Principles

Ch. 9.6 - Prob. 3COMQCh. 9.7 - 1. A double-stranded region of RNA a. forms a...Ch. 9 - 1. What is the meaning of the term genetic...Ch. 9 - Prob. 2CONQCh. 9 - 3. Look up the meaning of the word transformation...Ch. 9 - Prob. 4CONQCh. 9 - 5. Draw the structures of guanine, guanosine, and...Ch. 9 - Prob. 6CONQCh. 9 - 7. Describe how bases interact with each other in...Ch. 9 - Prob. 8CONQCh. 9 - 9. What is meant by the term DNA sequence? Ch. 9 - Make a side-by-side drawing of two DNA helices:...Ch. 9 - 11. Discuss the differences in the structural...Ch. 9 - What part(s) of a nucleotide (namely, phosphate,...Ch. 9 - List the structural differences between DNA and...Ch. 9 - Draw the structure of deoxyribose and number the...Ch. 9 - Write a sequence of an RNA molecule that could...Ch. 9 - Compare the structural features of a...Ch. 9 - Which of the following DNA double helices would be...Ch. 9 - What structural feature allows DNA to store...Ch. 9 - Prob. 19CONQCh. 9 - Prob. 20CONQCh. 9 - Prob. 21CONQCh. 9 - 22. On further analysis of the DNA described in...Ch. 9 - Prob. 23CONQCh. 9 - Prob. 24CONQCh. 9 - In what ways are the structures of an helix in a...Ch. 9 - Prob. 26CONQCh. 9 - Prob. 27CONQCh. 9 - 28. What chemical group (phosphate group, hydroxyl...Ch. 9 - The base composition of an RNA virus was analyzed...Ch. 9 - Prob. 30CONQCh. 9 - Prob. 31CONQCh. 9 - Prob. 32CONQCh. 9 - Prob. 33CONQCh. 9 - As described in Chapter 15, the methylation of...Ch. 9 - 35. An RNA molecule has the following sequence:...Ch. 9 - 1. Genetic material acts as a blueprint for an...Ch. 9 - 2. With regard to the experiment described in...Ch. 9 - Prob. 3EQCh. 9 - Prob. 4EQCh. 9 - 5. With regard to Chargaff’s experiment described...Ch. 9 - 6. Gierer and Schramm exposed plant tissue to...Ch. 9 - 1. Try to propose structures for a genetic...Ch. 9 - Prob. 2QSDC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY