Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 9, Problem 23CONQ
Summary Introduction
To review:
Prevention of deoxyribonucleic acid (DNA) binding protein from identifying double stranded ribonucleic acid(RNA) molecule.
Introduction:
DNA is also known as a polynucleotide chain. Nucleotides in DNA molecule are present in major and minor grooves and its backbone is made up of sugar and phosphate groups.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA:
3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'
Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________
Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47:
mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-
polypeptide chain: ________--________--________--________--________--________--________--________
Describe the d=features of the following DNA-binding domains and how they interact with DNA.
Helix-turn-Helix
Zinc Finger
Leucine Zipper
Helix-loop-Helix
The formation of a double-stranded structure must obey the rule that adenine hydrogen bonds to thymine (or uracil in RNA) and cytosine hydrogen bonds to guanine. Discuss reasons why complementarity is an important feature of DNA and RNA structure and function.
Chapter 9 Solutions
Genetics: Analysis and Principles
Ch. 9.1 - In the experiment of Avery, McLeod, and McCarty,...Ch. 9.1 - In the Hershey and Chase experiment involving T2...Ch. 9.2 - Going from simple to complex, which of the...Ch. 9.3 - Which of the following could be the components of...Ch. 9.3 - Prob. 2COMQCh. 9.4 - Prob. 1COMQCh. 9.5 - Prob. 1COMQCh. 9.5 - Prob. 2COMQCh. 9.6 - 1. Which of the following is not a feature of the...Ch. 9.6 - 2. A groove in the DNA refers to
a. the...
Ch. 9.6 - Prob. 3COMQCh. 9.7 - 1. A double-stranded region of RNA
a. forms a...Ch. 9 - 1. What is the meaning of the term genetic...Ch. 9 - Prob. 2CONQCh. 9 - 3. Look up the meaning of the word transformation...Ch. 9 - Prob. 4CONQCh. 9 - 5. Draw the structures of guanine, guanosine, and...Ch. 9 - Prob. 6CONQCh. 9 - 7. Describe how bases interact with each other in...Ch. 9 - Prob. 8CONQCh. 9 - 9. What is meant by the term DNA sequence?
Ch. 9 - Make a side-by-side drawing of two DNA helices:...Ch. 9 - 11. Discuss the differences in the structural...Ch. 9 - What part(s) of a nucleotide (namely, phosphate,...Ch. 9 - List the structural differences between DNA and...Ch. 9 - Draw the structure of deoxyribose and number the...Ch. 9 - Write a sequence of an RNA molecule that could...Ch. 9 - Compare the structural features of a...Ch. 9 - Which of the following DNA double helices would be...Ch. 9 - What structural feature allows DNA to store...Ch. 9 - Prob. 19CONQCh. 9 - Prob. 20CONQCh. 9 - Prob. 21CONQCh. 9 - 22. On further analysis of the DNA described in...Ch. 9 - Prob. 23CONQCh. 9 - Prob. 24CONQCh. 9 - In what ways are the structures of an helix in a...Ch. 9 - Prob. 26CONQCh. 9 - Prob. 27CONQCh. 9 - 28. What chemical group (phosphate group, hydroxyl...Ch. 9 - The base composition of an RNA virus was analyzed...Ch. 9 - Prob. 30CONQCh. 9 - Prob. 31CONQCh. 9 - Prob. 32CONQCh. 9 - Prob. 33CONQCh. 9 - As described in Chapter 15, the methylation of...Ch. 9 - 35. An RNA molecule has the following sequence:...Ch. 9 - 1. Genetic material acts as a blueprint for an...Ch. 9 - 2. With regard to the experiment described in...Ch. 9 - Prob. 3EQCh. 9 - Prob. 4EQCh. 9 - 5. With regard to Chargaff’s experiment described...Ch. 9 - 6. Gierer and Schramm exposed plant tissue to...Ch. 9 - 1. Try to propose structures for a genetic...Ch. 9 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardA duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 59 °C. If an RNA duplex oligonucleotide of identical sequence (substituting U for T) isconstructed, will its melting temperature be higher or lower?arrow_forward
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardDraw and label the following RNA tetranucleotide: 5’phosphoryl-A-2’O-methyl-C-U-G-3’-phosphatearrow_forwardIf a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAGarrow_forward
- Which of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′arrow_forwardIf a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the phosphodiester bond, what are the consequent nucleotide products of the hydrolysis of the 2 strands? (Please write the answers using only the letters corresponding to the bases with either the p or OH beside it to indicate the phosphate and OH groups respectively.) Sequence in one strand: TCGATCAGarrow_forwardUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.arrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'arrow_forwardFor the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?arrow_forwardDetermine the sequence of amino acids specified by the codons in the following information strand. AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC САА Then determine the sequence of amino acids if an insertion occurred to the left of the first adenosine and changed the reading frame as shown below. Notice that (1) the insertion is shown on the left by the lower-case “i", and (2) the bases are still in the same sequence; they are just shifted so that they are read differently. IAG GTC TTC AGG GAA TGC СTG GCG AGA GGG GAG CAG СTG GTA TCG CTG GGC CCA Suppose a single-nucleotide polymorphism occurred in the original strand to make the change shown below. Would this affect the resulting protein? Explain. This is the original strand AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TGG TAT CGC TGG GCC CAA This is the strand with the SNP. (The change is shown in red.) AGG TCT TCA GGG AAT GCC TGG CGA GAG GGG AGC AGC TAG TAT CGC TGG GCC САА Suppose a different single-nucleotide…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License