Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 29CONQ
The base composition of an RNA virus was analyzed and found to be 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you conclude that the viral genetic material is single-stranded RNA or double-stranded RNA?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The base composition of an RNA virus was analyzed and found tobe 14.1% A, 14.0% U, 36.2% G, and 35.7% C. Would you concludethat the viral genetic material is single-stranded RNA ordouble-stranded RNA?
Heinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry and Biology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded? Percentage A G C T U Ribgrass mosaic virus 29.3 25.8 18.0 0.0 27.0
The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33% U. Is this sufficient data to determine whether the genomic material is DNA/RNA and is double- or single-stranded? Why or why not? Explain, using a diagram
Chapter 9 Solutions
Genetics: Analysis and Principles
Ch. 9.1 - In the experiment of Avery, McLeod, and McCarty,...Ch. 9.1 - In the Hershey and Chase experiment involving T2...Ch. 9.2 - Going from simple to complex, which of the...Ch. 9.3 - Which of the following could be the components of...Ch. 9.3 - Prob. 2COMQCh. 9.4 - Prob. 1COMQCh. 9.5 - Prob. 1COMQCh. 9.5 - Prob. 2COMQCh. 9.6 - 1. Which of the following is not a feature of the...Ch. 9.6 - 2. A groove in the DNA refers to
a. the...
Ch. 9.6 - Prob. 3COMQCh. 9.7 - 1. A double-stranded region of RNA
a. forms a...Ch. 9 - 1. What is the meaning of the term genetic...Ch. 9 - Prob. 2CONQCh. 9 - 3. Look up the meaning of the word transformation...Ch. 9 - Prob. 4CONQCh. 9 - 5. Draw the structures of guanine, guanosine, and...Ch. 9 - Prob. 6CONQCh. 9 - 7. Describe how bases interact with each other in...Ch. 9 - Prob. 8CONQCh. 9 - 9. What is meant by the term DNA sequence?
Ch. 9 - Make a side-by-side drawing of two DNA helices:...Ch. 9 - 11. Discuss the differences in the structural...Ch. 9 - What part(s) of a nucleotide (namely, phosphate,...Ch. 9 - List the structural differences between DNA and...Ch. 9 - Draw the structure of deoxyribose and number the...Ch. 9 - Write a sequence of an RNA molecule that could...Ch. 9 - Compare the structural features of a...Ch. 9 - Which of the following DNA double helices would be...Ch. 9 - What structural feature allows DNA to store...Ch. 9 - Prob. 19CONQCh. 9 - Prob. 20CONQCh. 9 - Prob. 21CONQCh. 9 - 22. On further analysis of the DNA described in...Ch. 9 - Prob. 23CONQCh. 9 - Prob. 24CONQCh. 9 - In what ways are the structures of an helix in a...Ch. 9 - Prob. 26CONQCh. 9 - Prob. 27CONQCh. 9 - 28. What chemical group (phosphate group, hydroxyl...Ch. 9 - The base composition of an RNA virus was analyzed...Ch. 9 - Prob. 30CONQCh. 9 - Prob. 31CONQCh. 9 - Prob. 32CONQCh. 9 - Prob. 33CONQCh. 9 - As described in Chapter 15, the methylation of...Ch. 9 - 35. An RNA molecule has the following sequence:...Ch. 9 - 1. Genetic material acts as a blueprint for an...Ch. 9 - 2. With regard to the experiment described in...Ch. 9 - Prob. 3EQCh. 9 - Prob. 4EQCh. 9 - 5. With regard to Chargaff’s experiment described...Ch. 9 - 6. Gierer and Schramm exposed plant tissue to...Ch. 9 - 1. Try to propose structures for a genetic...Ch. 9 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The DNA sequence of the genome of a virus is known and contains equal number of A, TG and C. The genome is composed of double stranded DNA molecule. It is 10Kb in length. If one searches the genome for the presence of the following sequence 5'-AAAAAA-3'/3'-TTTTTT-5', predict the number of such stretches that are likely to occur. (1Kb = 1000 base pairs). a) Two b) Eight c) Sixteen d) Thirty twoarrow_forwardHeinz Shuster collected the following data on the base composition of ribgrass mosaic virus (H. Shuster, in The Nucleic Acids: Chemistry andBiology, vol. 3, E. Chargaff and J. N. Davidson, Eds. New York: Academic Press, 1955). On the basis of this information, is the hereditary information of the ribgrass mosaic virus RNA or DNA? Is it likely to be single stranded or double stranded?arrow_forwardIn a clinical context, a scientist is working with a viral DNA which is about 24000bps long. There are two known variants of the virus that share almost the same DNA but for a final fragment; with reference to Figure Q2b, the regions A and B are conserved in both variants, while the region C differs and is either 320bps (variant 1) or 380bps (variant 2). The scientist wants to set up a procedure to identify the variant they are dealing with. Viral dsDNA (i) (ii) (iii) Stable region (A) Variable region (C) Figure Q2b Known sequence (B) 5-GACCTCAATGTCCAGCGGTACGCTCATAAA-3' 3'-CTGGAGTTACAGGTCGCCATGCGAGTATTT-5' The scientists want to design a primer to amplify the variable region and to do so, they sequence a small fragment (sequence B) the conserved region close to the variable region C. Why is the scientist targeting a region outside of the fragment of interest? [3] The sequence of the fragment B is reported in Figure Q2b. Suggest a primer that can efficiently target this region and…arrow_forward
- A DNA sequence consists of a string of elements called nucleotides, in a defined order. Suppose the DNA sequence of a virus is 20 nucleotides long. If each nucleotide can be either a G, T, C, or A, how many different sequences are possible?arrow_forwardTwo theoretical genetic strains of a virus (a-b-c- and a+b+c+) were used to simultaneously infect a culture of host bacteria. Of 10,000 plaques scored, the following genotypes were observed. Determine the genetic map of these three genes on the viral chromosome. Decide whether interference was positive or negative. a+ b+ c+ 4100 a- b+ c- 160 a- b- c- 3990 a+ b- c+ 140 a+ b- c- 740 a- b- c+ 90 a- b+ c+ 670 a+ b+ c- 110arrow_forwardRNA was extracted from certain virus and found to contain 35% cytosine. With this information, is it possible to predict what percentage of the bases in virus are adenine? If so, what percentage? If not, why not?arrow_forward
- Are they true or false? a)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml. b)If someone reads an absorbance of 0,25 at 260 nm, the concentration of the dsDNA is 25 ug/ml c)The copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell. d)The amount of mRNA level can be determined via competitor RT-PCR in which two different sized products can be obtained, one of which is a known standard.arrow_forwardGerman measles results from an infection of the rubella virus, which can cause a multitude of health problems in newborns. What conclusions can you reach from a nucleic acid analysis of the virus that reveals an A + G/U + C ratio of 1.13?arrow_forward, The E. coli genome is 4.6 Mbp (mega base-pairs). What is the physical length of the E. coli genome?arrow_forward
- Bacteriophages are viruses that infect bacteria. Depending on the bacteriophage, their genome can be made of either single or double stranded DNA or RNA. The composition of genetic material found in a bacteriophage is found to be 25% A, 33% T, 24% G, and 18% C. What can you conclude about the genetic material of this virus? a. It is double-stranded DNA. b. It is single-stranded DNA. c. It is single-stranded RNA. d. It is double-stranded RNA.arrow_forwardIf your analysis identifies that the total Cytosine content in a sample is 29%, what will be the total Adenine content (as a %)?arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license