Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 5P
Interpretation Introduction
(a)
Interpretation:
The complementary sequence for GATCAA in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
Interpretation Introduction
(b)
Interpretation:
The complementary sequence for TCGAAC in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
Interpretation Introduction
(c)
Interpretation:
The complementary sequence for ACGCGT in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
Interpretation Introduction
(d)
Interpretation:
The complementary sequence for TACCAT in 5’-3’ notation should be determined.
Concept introduction:
The two stands of DNA are not identical; they are complementary to each other which results from base pairing. The base pairing takes place via hydrogen bonding between the two strands.
DNA sequencing is a process that determines the order of four bases A (adenine), T (thymine), G (guanine), C (cytosine).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Compute the percent identity of the following pairwise sequence alignment:
-TGAGACTTAGAGT
|..|... | | | | |
ATAGGAGCGAGAGT
Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b) ACCCA (c) GTGTC
Are the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCG
Chapter 4 Solutions
Biochemistry
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Compute the PERCENT IDENTITY for the following pairwise sequence alignment. ACTGATGGGGG--AGACGTA ||||| ... I ||||||| ACTG--AAAAGCTAGACGTAarrow_forwardLow-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a mođel that explains this scenario. 5. The right-hand panel in the linked figure shows sedimentation equilibrium analytical ultracentrifugation data for a mixture containing equimolar amounts of two fibrous proteins, Vps27 and Hsel. The blue circles are the data and the black line is the expected plot for a monodisperse 1:1 Vps27:Hsel complex of 23.7 kDa. In the left-hand panel, data is shown for Vps27 alone. The black line represents the expected curve for monomeric Vps27. Both experiments were run under identical conditions (same buffer, same spinning speed etc.) and the proteins have the same partial specific volume.arrow_forwardIn biochemical and structural terms, how does the cellular form of the prion protein differ from the infectious form? Can you also explain what is the biochemical basis for “infectiousness” of the prion protein?arrow_forward
- Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a model that explains this scenario.arrow_forward(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?arrow_forward5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13arrow_forward
- Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.arrow_forward2A Draw the complete structure of the trinucleotide 5'-A-G-C-3' (DNA).arrow_forwardusing, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?arrow_forward
- Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.arrow_forwardBased on the alignment of these protein sequences below, which [pairs] of the genes appear to be most similar to each other? [at least mention 2 points]; Why? [at least mention 2 points] Image of the protein sequences :arrow_forwardAre the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to 3′. (a) A-C-G-G-A and T-G-C-C-T (b) G-T-G-A-C and C-A-T-G-G(c) G-T-A-T-A and A-C-G-C-Garrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY 
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY