Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.
Q: includes
A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…
Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…
A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…
Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the…
A: The function of the other codons is stop codon i-e to stop the translation.
Q: If a protein is created via the translation of 705 nucleotides, including a start and a stop codon,…
A: Central dogma is the process in which RNA is produced from the DNA (transcription) and amino acid…
Q: What two reaction steps are required for the formation of an aminoacyl-tRNA?
A: In molecular biology, translation is the cycle wherein ribosomes in the cytoplasm or endoplasmic…
Q: Briefly describe each of the following possible posttranslational protein modifications. Give an…
A: The deoxyribonucleic acid (DNA) is the genetic material of the organism that is transcripted to form…
Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…
A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…
Q: It is possible for the codons for a single amino acid to have the first two bases in common and to…
A: mRNAs contain trinucleotide sequences known as codons. The ani-codon site of the tRNA recognizes the…
Q: Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second…
A: The mRNA (messenger ribonucleic acid) is synthesized from a DNA (deoxyribonucleic acid) template.…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…
Q: Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of…
A: The probability that a protein molecule is completely error free is (1-δ)n, where n is the number of…
Q: A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B…
A: Ans: Protein domain: The protein carries separate region in the polypeptide protein which shows…
Q: 5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation…
A: Yes, it is possible for a single base pair substitution to cause a truncation in the peptide as…
Q: Why is posttranslational modification necessary for a protein to be functional?
A: Post-translational Modifications: The covalent and enzymatic modification of proteins…
Q: The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the…
A: tRNA or transfer RNA is the RNA molecule that attaches to an amino acid as per the anticodon…
Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…
A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: The following triplets constitute anticodons found on a series of tRNAs. Name the amino acid carried…
A: Transfer RNA (ribonucleic acid) is a single-stranded RNA molecule that is used in the translation.…
Q: The following polynucleotide was synthesized and used as a template for peptide synthesis in a…
A: The DNA template is used to form an mRNA polynucleotide by the process of transcription. The mRNA…
Q: From this overall anticodon sequence in tRNA,…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design…
A: Sealing is the joining of two DNA (deoxyribonucleic acid) segments under in-vitro conditions. The…
Q: When glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein…
A: Proteins with covalently linked sugar residues are known as glycoproteins. Sugars' hydrophilic and…
Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…
A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…
Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…
A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…
Q: What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating…
A: The messenger RNA (mRNA) is a molecule produced during the process of transcription where the enzyme…
Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…
A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…
Q: What would the peptide sequence be like after translation?
A: Translation is the process by which polypeptide or protein is produced from the mRNA by the help of…
Q: Most proteins have more leucine than histidine residues, but more histidine than tryptophan…
A: A genetic code is a set of three nucleotides.
Q: (a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many…
A: The process of translation or protein synthesis occurs in the cytoplasm of a cell in both…
Q: From this overall anticodon sequence in tRNA,…
A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…
Q: Why do you think the motif of the DNA-binding protein shown is called a zinc-finger motif?
A: Each protein has unique features. However, most bind to DNA as homodimers or heterodimers and…
Q: A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon…
A: DNA is the carrier of genetic information in almost all organisms except certain RNA viruses such as…
Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…
A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…
Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…
A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…
Q: . The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis…
A: Polypeptide is made up of chain of amino acids linked together. Polypeptides are connected together…
Q: For each of the following sequences, rank them in order (from best to worst) as sequences that could…
A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…
Q: Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence…
A: Fibroins are insoluble proteins that are present in silk produced by insects, such as the larvae of…
Q: The Hemagglutinin protein in Influenza virus contains a remarkably long a- helix (7.95 nm) with 53…
A: Option H, 14.7
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…
A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…
Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?…
A: We know that the mRNA carries the codon and the tRNA carries the anticodon. The transfer RNA is the…
Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…
A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…
Q: In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for…
A: tRNA is the transfer RNA and an adapter molecule made up of RNA serving as the physical link between…
Q: If a tRNA molecule carries a glutamic acid, what are the two possible anticodon sequences that it…
A: An anticodon is a trinucleotide sequence that is complementary to that of a corresponding codon in…
The translation is the process of making a polypeptide chain from mRNA. The translation is catalyzed by several proteins, tRNA, and ribosomes.
According to the question, the error rate for translation is 1*10-4, meaning that the translation machinery makes one error per 10,000 amino acids incorporated.
a. The given peptide has 100 residues.
b. The given peptide has 1000 residues
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of making a perfect protein of 100 residues.(b) Repeat for a 1000-residue protein.Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'
- A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.You have discovered a novel protein that has a pI = 5.5. To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid changes—namely, a surface Phe residue in the normal protein has been replaced by His (side chain pKa = 6.1) and asurface Gln has been replaced by Glu (side chain pKa = 6.0). Is the pI of themutant protein predicted to be greater than, less than, or the same as the pIof the normal protein? Support your answer with the appropriate calculationA double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides, called vir-1 and vir-2. Adding this double-stranded DNA fragment to an in vitro transcription and translation system yields peptides of 10 residues (vir-1) and 5 residues (vir-2). Solve, (b) Determine the amino acid sequence of each peptide.
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs (what letters changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions (with spaces), and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - CCTCGTTATGTG - 5' Mutated DNA Sequence: 3' - CCTCGTTATTTG - 5'5'......TACTGCCCATGCCCAGAGAGAAAGCGCAGACGCGTCTAAactgt... 3' a). (10 points). In the above sequences, the open reading frame is indicated by alternating non-underlined and underlined triplets. Please use the codon table to deduce the amino acid sequence for the region shown in the wildtype protein. Wildtype AA sequence for the region around mutation #1: Wildtype AA sequence for the region around mutation #2: b). (10 points). Please make predictions what molecular change mutation #1 and mutation #2 cause. c). (5 points). Which mutation is more likely to abrogate the protein function? Why?Give the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b) ACCCA (c) GTGTC
- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)