A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given. Concept introduction: The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Question

Want to see the full answer?

Answer 1

Question

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGAT

Compare the melting temperature of a 1-kb segment of DNA containing20% A residues to that of a 1-kb segment containing 30% A residues under the same conditions.

Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand DNA that is known to contain 20%T. Show work.

Answer 2

Question

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Answer 6

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Answer 7

Chapter 4, Problem 49P

Interpretation Introduction

Interpretation:

A reasonable explanation for the relation between % of GC base pairs in DNA and the melting temperature needs to be given.

Concept introduction:

The GC base pair i.e. Guanine - Cytosine pair help the DNA to maintain its helical structure which is dependent on the nucleotide sequences. A base pair is a unit structure which contains two nucleotides connected by hydrogen bonds to each other. These nucleotide strand connected by the hydrogen bond of the base pairs are stable at room temperature, but they separate above a melting point which is defined by the length of the molecule, the extent of mispairing and the amount of GC content in it. Higher GC content makes the melting point higher.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 4 - Prob. 1P Ch. 4 - Prob. 2P Ch. 4 - Prob. 3P Ch. 4 - Prob. 4P Ch. 4 - Prob. 5P Ch. 4 - Prob. 6P Ch. 4 - Prob. 7P Ch. 4 - Prob. 8P Ch. 4 - Prob. 9P Ch. 4 - Prob. 10P

Solution Summary: The author explains the relationship between % of GC base pairs in DNA and the melting temperature.

Concept explainers

Videos

Want to see the full answer?

Chapter 4 Solutions