Q: Q.3. What do you think is more dangerous - Active smoking or passive smoking? State why.
A: Introduction In this question we will discuss about the Active smoking and passive smoking.
Q: 8. (a) What are cardiac glycosides? Give one example of cardiac glycoside and draw structure.…
A: The cardiovascular system is a network of arteries and veins in which the heart pumps blood. One of…
Q: Why is Raphanobrassica fertile, whereas its progenitorwasn’t?
A: Raphanobrassica. Any intergeneric hybrid between Brassica (cabbages, etc.) and Raphanus is known as…
Q: Q.2. Describe the individuals with the following chromosomal abnormalities: 1. Trisomy at chromosome…
A: 1) Trisomy - Trisomy results in Down's syndrome, which is an autosomal-linked genetic disorder that…
Q: Which factor is not required for natural selection to occur?
A: This question is based on evolution and natural selection.
Q: Question 3 What are the diseases associated with hypocomplementaemia and which complement deficiency…
A: Hypocomplementaemia is the disease of the immune system in which the amount of the complement…
Q: Organisms that produce offspring that always look like the parents are said to be: O Purebred/Pure…
A: Organisms that produce offsprings that always look like the parents are said to be.
Q: Which molecules regulate cross-bridge attachment activity? O a. tropomyosin and M lines O b. calcium…
A: The Muscular System is a vital physiological system that humans require in order to exist. This…
Q: (i) What type of transmembrane protein is it? || (ii) Does it have an N-terminal peak above 2 on a…
A: Membrane proteins are responsible for most of the dynamic process carried out by membranes. Most…
Q: Discuss the environmental consequences of biomaterials compared to non-biomaterials.
A: A biomaterial is a substance that has been developed to interact with biological systems for…
Q: What is a recombinant DNA vaccine? List two such vaccines. State their advantages.
A: Plasmids, which are small circular pieces of DNA, are used in the production of recombinant DNA…
Q: 3. Listed within this chart are descriptions of a variety of DNA mutations. Your job is to fill in…
A: *Mutations cause change in DNA sequence thar are resulted from DNA copying errors during cell…
Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…
A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…
Q: In bacteria, the ___consensus sequence of mRNA binds to the ____rRNA of the 30S small subunit during…
A: * Translation is the process in which genetic code is present in a messenger RNA molecule is decoded…
Q: Question 16 In base-excision repair, the first enzyme in the sequence is, _ creating a(n) _ site. (A…
A: INTRODUCTION Base excision repair This is a cellular mechanism that repairs damaged DNA.
Q: Is salamander more closely related to shark or human? shark salamander lizard armadillo human C В A…
A: Cladograms - is a tree like structure that shows how organism are related. In a cladograms, the…
Q: Consider the components of fatty-acid degradation and fatty-acid synthesis on the left. The…
A: Fatty acid synthesis It is the formation of fatty acids. The pathway involves acetyl-CoA and NADPH…
Q: (c) Draw the absolute configuration of Cholesterol. How Progesterone can be synthesized from…
A: Basic nucleus of cholesterol is formed by a sterol nucleus. This sterol nucleus is made of four…
Q: Discuss the scientific approach to human sexuality from a historical perspective.
A: Human sexuality is a term that defines an integral part of the personalities and way of expressing…
Q: Diagram a translocation arising from repetitive DNA.Repeat for a deletion.
A: Changes in the structure of chromosomes may create issues with the body's systems' development,…
Q: Q.6. How far are the genes and environment responsible for the expression of a particular trait?
A: Introduction We will answer the question in below step.
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: * Skeleton is the framework of human body which is composed of 270 bones at birth and can be…
Q: Q.2. Comment on the statement, "Migration may increase or decrease the effects of selection".
A: Introduction We will comment on the statement given in the question.
Q: DNA ligases will seal all nicks there are in the DNA strands during the replication process and in…
A: DNA nicks introduced during the process of replication, recombination or repair if left unchecked,…
Q: Partial 0.75 /1 pts Question 8 Where is carbon stored on Earth? Check all that apply. V rocks and…
A: Carbon is one of the most important elements to humans since all organic compounds and most…
Q: Name the four classes of bones? a) Long, short, regular, irregular b) Big, small, flat, bulged c)…
A: Bone is a mineralized connective tissue . The matrix of bone is made up of calcium and phosphate…
Q: Question 9 The mechanism for all template-directed synthesis of any type of nucleic acid involves…
A: Template strand The template strand is the strand of DNA which replicate itself during the process…
Q: (a) QI a. Justify why the base thyamine is prefered ove guanine in DNA while the reverse is…
A: DNA as well as RNA is made up of large number of monomers called nucleotide. This nucleotide is…
Q: Question 26 The initial event in the conversion of an hnRNA to the mature RNA which leaves the…
A: Answer is D
Q: In Figure 17-28, what would be the consequence of acrossover between the centromere and locus A?
A: The exchange of chromosomal segments between nonsister chromatids in meiosis is known as crossing…
Q: Which of the following DNA pol I activities would be MOST important in the removal of the primer? A…
A: The DNA polymerase I has two actions: - Synthesis of Okazaki fragments to complete gaps. 5/ to 3/…
Q: Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the…
A: * Okazaki fragment are short sequences of DNA nucleotides. * They are of approximately 150 to 200…
Q: Spongy bones do not have a haversian system. a) False b) True
A: Introduction - Compact bone is more dense and lighter than spongy (cancellous) bone. Plates…
Q: Species richness quantifies the amount of money each species is valued at on the biodiversity stock…
A: Species richness quantified?
Q: Which of the following statements about biotic potential is TRUE? Biotic potential of an organism…
A: Introduction Biotic potential:- It is the ability of a population of living species to increase…
Q: Please could you explain how lymphocytes (especially B) can maintain receptors on their surfaces? Is…
A: Lymphocytes are a type of white blood cell that plays an important role in the immune system. They…
Q: Q.8. What is recombination? Mention its applications with reference to genetic engineering.
A: In genetics recombination is the main mechanism by which variations are introduced into the…
Q: Explain rna splicing in eukaryotes
A: The "translation" is the process through which mRNA codes for a certain protein. The ribosome…
Q: Why are older expectant mothers routinely given amniocentesis or CVS?
A: Prenatal diagnostic procedures such as chorionic villus sampling (CVS) and amniocentesis are used to…
Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…
A: Sperms are the male gametes produced in the seminiferous tubule present in testicular lobules.…
Q: Why are antibiotics not allowed in the treatment of rotaviruses?
A: Rotavirus Rotavirus is a double stranded RNA virus belong to the family of Reoviridae. It causes…
Q: lence: -T -G FG -A If RNA primase used this section of DNA to make a primer, what would be the…
A: RNA primase is an enzyme used in DNA replication. It produces RNA primer.
Q: 1111 ) cY TO PLASMIC FRACION (UNTREATED CELS) 2. ) CYTOPLASWMIC FRA CIION ( LPS TREATEO) 4) NuCLEAie…
A: Lane 1 consist of know molecular weight to which comparision can be done with those of other lanes…
Q: Which of the following does NOT tend to promote genetic divergence between populations? a)…
A: The genetic diversity has three different sources: mutation, recombination and immigration of genes.
Q: explain what is similar and what is different from the bacteriophages of covid-19
A: Bacteriophages or phages are the viruses that infect and kill bacteria. Bacteriophages consist of a…
Q: . Why is Drosophila used extensively for genetic studies?
A: The characteristics which made an organisms particularly good mondel for genetic experimentation are…
Q: Bob is a 19-year old male, who is 6’3”, and weights 160lbs. You tested Bob’s 1.5-mile run time, and…
A: Absolute VO2 max is without a doubt the amount of oxygen you breathe in liters in line with a…
Q: The eukaryotic metallothionein gene promoter consists of all EXCEPT:
A: A promoter is a region of DNA where RNA polymerase begins to transcribe a gene.
Q: What do you mean by "survival of the fittest"?
A: Introduction In this question we will discuss about the "survival of the fittest"
Q: An individual with an argininosuccinase deficiency is administered benzoate and arginine. This…
A: Argininosuccinase deficiency is a condition where the cells are devoid of an important enzyme i.e.…
Step by step
Solved in 2 steps
- 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3′ What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU U UUC UUA UUG CUU C CUC CUA CUG U Leu GUA GUG CCU Leu CCC CCA CCG AUU ACU A AUC ACC AUA ACA AUG Met ACG lle UCC Ser UCA UCG GUU GCU G GUC Val GCC с GCA GCG Second Letter Pro Thr Ala A | Tyr UAU UAC UAA Stop UAG Stop CAU His CAC CAA Gin CAG AAU Asn AAC AAA AAG GAU GAC GAA GAG UGU Cys U UGC UGA Stop A UGG Trp G AGU AGC AGA Lys AGG | Asp Glu CGU CGC Arg CGA CGG Arg UCAG ULAG SCAG GGU GGC Gly GGA GGG с Ser U letter 3rd GAssume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of making a perfect protein of 100 residues.(b) Repeat for a 1000-residue protein.
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 215'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAGConsider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
- Assume that the translational error frequency, 8, is 1 × 10-4. (a) Calculate the probability of making a perfect protein of 100 residues. (b) Repeat for a 1000-residue protein.A recent genome sequencing project for the bacterium Burkholderia mallei has identified a new protein with high similarity to the lysylphosphatidylglycerol flippase enzyme. A short section of the new protein sequence is shown below. TVEVNAPGDVQKALSELQQINDGRLDIRI (a) Are any reverse turns likely to be present? Explain your answer. (b) Are any beta-strands likely to be present? Explain your answer. (c) Are any alpha helices likely to be present? Explain your answer. (d) Is any supersecondary structure likely to be present? Explain your answer. (e) Identify two residues that are likely to be buried in the core of the folded protein. Explain your answer. (f) Identify two residues that are likely to be hydrogen bonded to each other. Explain your answer.5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13
- Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a model that explains this scenario.3 of 3 A protein was completely digested with trypsin and an internal peptide (i.e. not derived from the N- or C-terminals) was purified. Determine its sequence from the following information: a) amino acid analysis yields one mole of D, T, P, L, Y, F, K, and R per mole of peptide; b) treatment of the intact peptide with FDNB, followed by acid hydrolysis, gives DNP-L and &-DNP-K; c) treatment of the intact peptide with chymotrypsin yields a tripeptide containing K, T, and D; a tetrapeptide containing P, L, F, and R, and free tyrosine; d) the tripeptide, in part c, yields DNP-T and ɛ-DNP-K after reaction with FDNB and acid hydrolysis. Note: trypsin will not cleave on the carboxyl side of arginine or lysine if the next amino acid (donating the amino group) is proline. Put your answer here:Low-resolution X-ray diffraction analysis of a protein composed of long stretches of the sequence (-Gly-Ser-Gly-Ala-Gly-Ala-)n, where n indicates any number of repeats, shows an extended structure of stacked layers, with a repeat distance between layers that alternates between 3.5 Å and 5.7 Å. Propose a mođel that explains this scenario. 5. The right-hand panel in the linked figure shows sedimentation equilibrium analytical ultracentrifugation data for a mixture containing equimolar amounts of two fibrous proteins, Vps27 and Hsel. The blue circles are the data and the black line is the expected plot for a monodisperse 1:1 Vps27:Hsel complex of 23.7 kDa. In the left-hand panel, data is shown for Vps27 alone. The black line represents the expected curve for monomeric Vps27. Both experiments were run under identical conditions (same buffer, same spinning speed etc.) and the proteins have the same partial specific volume.