Concept explainers
(a)
Interpretation:
The DNA Polymerase and RNA Polymerase from E. coli needs to be compared on the basis of the activated precursors.
Concept introduction:
DNA Polymerase is an enzyme that helps in the formation of DNA from deoxyribonucleotide, a unit structure of a DNA. This enzyme helps in replication of the DNA strand to form the double helical structure of the DNA. DNA Polymerase reads the existing strand of DNA and synthesizes the new strand which is a replica of the existing strand.
RNA Polymerase is an enzyme that initiates RNA synthesis from a DNA template. This RNA polymerase enzyme opens the double-stranded DNA to expose one strand of the
(b)
Interpretation:
The DNA Polymerase and RNA Polymerase from E. coli needs to be compared on the basis of
the direction of chain elongation.
Concept introduction:
DNA Polymerase is an enzyme that helps in the formation of DNA from deoxyribonucleotide, a unit structure of a DNA. This enzyme helps in replication of the DNA strand to form the double helical structure of the DNA. DNA Polymerase reads the existing strand of DNA and synthesizes the new strand which is a replica of the existing strand.
RNA Polymerase is an enzyme that initiates RNA synthesis from a DNA template. This RNA polymerase enzyme opens the double-stranded DNA to expose one strand of the nucleotide so that it can be used as the template for RNA Synthesis.
(c)
Interpretation:
The DNA Polymerase and RNA Polymerase from E.coli needs to be compared on the basis of
conservation of template.
Concept introduction:
DNA Polymerase is an enzyme that helps in the formation of DNA from deoxyribonucleotide, a unit structure of a DNA. This enzyme helps in replication of the DNA strand to form the double helical structure of the DNA. DNA Polymerase reads the existing strand of DNA and synthesizes the new strand which is a replica of the existing strand.
RNA Polymerase is an enzyme that initiates RNA synthesis from a DNA template. This RNA polymerase enzyme opens the double-stranded DNA to expose one strand of the nucleotide so that it can be used as the template for RNA Synthesis.
(d)
Interpretation:
The DNA Polymerase and RNA Polymerase from E.coli needs to be compared on the basis of
need for primer.
Concept introduction:
DNA Polymerase is an enzyme that helps in the formation of DNA from deoxyribonucleotide, a unit structure of a DNA. This enzyme helps in replication of the DNA strand to form the double helical structure of the DNA. DNA Polymerase reads the existing strand of DNA and synthesizes the new strand which is a replica of the existing strand.
RNA Polymerase is an enzyme that initiates RNA synthesis from a DNA template. This RNA polymerase enzyme opens the double-stranded DNA to expose one strand of the nucleotide so that it can be used as the template for RNA Synthesis.
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
Biochemistry
- DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its absence. (a) What is the mechanism of this reaction, and why does it depend on AMP? (b) How could you determine that supercoiled DNA had in fact been relaxed?arrow_forwardCompare DNA polymerase, RNA polymerase, poly(A) polymerase, and CCA-adding polymerase with respect to requirement for a primer, template, and substrates.arrow_forwardCorrect order ib which the following enzynes would operate to fix a damaged nucleotide in a human gene. a) nuclease, DNA polymerase, RNA primase b) helicase, DNA polymerase, DNA ligase c) DNA ligase, nuclease, helicase d) nuclease, DNA polymerase, DNA ligasearrow_forward
- DNA ligase has the ability to relax supercoiled circular DNA in the presence of AMP but not in its absence. (a) What is the mechanism of this reaction, and why is it dependent on AMP? (b) How might one determine that supercoiled DNA had in fact been relaxed?arrow_forwardA temperature-sensitive mutation is one in which the defect is not presented functionally until the temperature is raised. In the case described below, the enzymes function normally in bacteria at 37 °C, but are non-functional at 40 °C. Predict the detailed molecular consequences of a loss of function in a temperature-sensitive mutant for each of the following enzymes: a) DNA gyrase, b) DNA polymerase III, c) DNA ligase, d) DNA polymerase I.arrow_forward Proofreads each nucleotide its template as soon as it is added to the growing strand. A) DNA Ligase B) Helicase C) DNA Polyerase D) Primase The genetic code A) has no redundancy but does have ambiguity B) has both redundancy and ambiguity C) has redundancy and not ambiguity D) has ambiguity E) has redundancyarrow_forward
- (a) How fast does template DNA spin (expressed in revolutions per second) at an E. coli replication fork? (b) What is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme relative tothe template?arrow_forward3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.arrow_forwardLocate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a nucleotide; (q) mRNA cap; (r) peptide bond; (s) P site; (t) aminoacyl-tRNA synthetase; (u) hydrogen bond; (v) exon; (w) 5′ AUG 3′; (x) potential wobble interaction.arrow_forward
- . Propose a mechanism by which a type II topoisomerase could use the energy of ATP hydrolysis to scan a large DNA molecule and, thereby, to direct that the enzyme will catalyze largely “disentan- gling" reactions (decatenation and unknotting).arrow_forwardIn Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.arrow_forwardWhat is the velocity of movement (in micrometers per second) of DNA polymerase III holoenzyme relative to the template?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON