Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 21, Problem 15EQ
Summary Introduction
To analyze:
The oligonucleotide sequence for the given DNA (deoxyribonucleic acid) sequence.
5’- GCCCCCGATCTACATCATTACGGCGAT -3’
3’- CGGGGGCTAGAT GTAGTAATGCCGCTA -5’
Introduction:
The production of the cloned segment of the DNA (deoxyribonucleic acid) that is mutated at a single site is termed as site-directed mutagenesis. The effect of a mutation can be observed on the organism. The nitrogen bases of the DNA that encode the information about the polypeptide or protein synthesis are mutated by using the changes in oligonucleotide sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):
5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’
By in vitro translating the mRNA, you determined that the translated peptide is 15 amino acids long. What is the expected peptide sequence in single letter abbreviations?
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS
5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’
Answer the following questions:
Q1. Which is the coding strand? Which is the template strand? [10%]
Top-bottom.
Bottom-Top.
Both can be used as either coding or template for this gene.
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS
5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt
What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED
[10%]
39 AA
13 AA
12 AA
21 AA
Chapter 21 Solutions
Genetics: Analysis and Principles
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A portion of the sequence from the DNA coding strand of the chick ovalbumin gene is shown. Determine the partial amino acid sequence of the encoded protein. CTCAGAGTTCACCATGGGCTCCATCGGTGCAGCAAGCATGGAA-(1104 bp)-TTCTTTGGCAGATGTGTTTCCCCTTAAAAAGAA Enter the 3-letter abbreviation for each amino acid in sequence, separated with dashes, and no spaces (example: xxx-xxx-XXX-XXX...) The amino acid sequence is .1104bp..…........arrow_forwardHelp me pleasearrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forward
- The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYarrow_forwardPart of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucinearrow_forwardBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?arrow_forward
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG Garrow_forwardThe sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.arrow_forwardFor the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forward
- Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal determination, a biochemist found out that there are two N-terminal amino acid residues, V and G. What is the original sequence of the protein given the following peptide fragments: after digestion with Chymotrypsin: G-L-S-R-G-M-w V-A-L-F Q-L-Y L-R-V-W G-M-V-E-A-D-I-P K-S-P-E-M-T-W R-M-A-S-E-K-P-G-H after digestion with Trypsin: P-G-H V-W-G-M-V-E-A-D-I-P M-A-S-E-K G-M-W-Q-L-Y-L-R S-P-E-M-T-W-R G-L-S-R V-A-L-F-K after digestion with Cyanogen Bromide: T-W-R-M W-Q-L-Y-L-R-V-W-G-M V-E-A-D-I-P A-S-E-K-P-G-H V-A-L-F-K-S-P-E-M G-L-S-R-G-Marrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardBelow is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License