Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 21, Problem 2EQ
Summary Introduction
To review:
The order of the sticky ends of several enzymes provided in table 21.3.
Introduction:
The techniques of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present.
In the tables below G^AATTC means that the end after cutting with enzyme will be:
-----G 3'
-----CTTAA 5'
GTGCA^C means that the end will be:
-----GTGCA 3'
-----C 5'
Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?
AccI
GT^CGAC
BamHI
G^GATCC
ClaI
AT^CGAT
NsiI
ATGCA^T
PstI
CTGCA^G
BglII
A^GATCT
TaqI
T^CGA
A group of overlapping clones, designated A through F, is isolated from one region of a chromosome. Each of the clones is separately cleaved by a restriction enzyme, and the pieces are resolved by agarose gel lectrophoresis,with the results shown below. There are nine different restriction fragments in this chromosomal region, with a subset appearing in each clone. Using this information, deduce the order of the restriction fragments in the chromosome.
Chapter 21 Solutions
Genetics: Analysis and Principles
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forwardA 10 kb DNA fragment digested with the restriction endonuclease EcoRI yields fragments of 4 kb and 6 kb. When the 10 kb fragment is digested with BamHI, three fragments of 1, 3.5 and 5.5 kb are generated. Digestion with both enzymes yields four fragments of 0.5, 1, 3 and 5.5 kb. Draw the restriction map for the 10 kb fragment based on the data. Label the cut sites for the two enzymes, and the lengths between the cut sites.arrow_forwardA molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)arrow_forward
- When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?arrow_forwardFor a restriction enzyme that recognizes the restriction site GGCC, Which of the following statements is/are true?arrow_forwardA small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forward
- Restriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forwardWhen the restriction endonuclease EcoRI is used to digest a 10 kb DNA fragment, it produces 4 kb and 6 kb-sized fragments. Digesting the 10 kb fragment with BamHI yields three fragments, each ranging in size from one to three and a half kilobytes. Four pieces of 0.5, 1, 3 and 5.5 kb are formed after using both enzymes. Create a restriction map for this 10 kb piece of DNA using the information you have collected. Make a note of where the two enzymes cut, as well as the distances between the enzymes.arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forward
- A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA band while linear DNA shows two fragments. Explain.arrow_forwardAssume that a circular plasmid is 3200 base pairs in length and has restriction sites for HindIII restriction enzyme at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion.arrow_forwardThe map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license