Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found.                  5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC                                             GCCACTGATCATTA–3’

Q: For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show…

A: Polymerase (PCR) chain reaction is a process in which small DNA fragments are amplified into a…

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: Watch the following video called "Human Genome Project Video"…

A: Decoding the human genome has provided a wealth of information that is revolutionizing medicine,…

Q: Below is a DNA sequence of the coding strand for a small gene. This gene has no introns.

A: 1. This is a prokaryotic gene because of the absence of introns. In eukarytoes, both introns and…

Q: please list all possible products in a sequencing reaction using ddGTPA as a terminator based on the…

A: Ans: Chain termination sequencing: It is sanger sequencing method developed by Frederick sanger. The…

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: 2. Design a primer pair using NCBI Primer-BLAST for gene RNA 2',3'-cyclic phosphate and 5'- OH…

A: Forward primer:A primer that binds to antisense or plus strand of DNA is called as forward…

Q: Design primers that will amplify the following region of DNA (assume this is one strand from a…

A: The forward primer is designed to anneal to the template DNA strand at the 5' end of the target…

Q: The following data shows bisulfite sequencing results for a small region of the genome. How many…

A: The process by which the methyl groups are added to the DNA is called the DNA methylation.…

Q: Based on the sequence data in the figure above, would you consider the patient to be not affected,…

A: Based on the information provided in the figure above, it can be concluded that the patient is…

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: Write the base sequence of the DNA template from which this RNA sequence was derived: UGUUACGGA. How…

A: Transcription  Cellular process in which RNA is synthesized using DNA as a template known as…

Q: The illumina method of sequencing uses a unique type of nucleotide building block. What is the…

A: The illumina sequencing is a DNA sequencing method used to determine single nucleotide bases of a…

Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…

A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…

Q: Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in…

A: Introduction :  The translated form of the DNA sequence is the amino acid sequence. The DNA sequence…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…

A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…

Q: Design a pair of primers (22 nucleotides long each) for the following sequence to clone the full…

A: Primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. It is used…

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs.  Complementary base pairs…

Q: The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown…

A: The objective of the question is to identify the coding and template strands in the given DNA…

Q: Describe the benefits of using bacteria, yeast, mammalian and insect cells to make recombinant…

A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: A diploid organism with a 45,000-kb haploid genome contains 21% G residues. Calculate the number of…

A: According to Chargaff's rules, DNA from each cell of any organism should contain a 1:1 ratio (base…

Q: please identify structure information about this gene which is adgrg1/gpr56. You can identify…

A: Introduction :- Adgrg1 /Gpr56 (Adhesion G-protein coupled receptor G1 ) as its name indicates that…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: Consider the following coding sequence transcribed from 5' to 3' 5' A T G A A G C G C T C A G T A 3'…

A: Substitution of guanine at position 11 would result in to conversion of UCA into UGA (which is a…

Q: The consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is…

A: For Cas9 to work, it additionally requires a particular protospacer adjacent motif (PAM) that…

Q: Please list all possible products in a sequencing reaction using ddGTP as a terminator based on the…

A: 1.As dd GTP is used, every time it encounters C base it will terminate. 2.When C is encountered with…

Q: Why is it important that the correct reading frame is used?

A: DNA contains both coding and non-coding region where introns are non-coding regions and exons are…

Q: Write the detail or exact information of the follwoing of molecule “X” with UniProtKB accession…

A: ITGB6 Integrin alpha-V:beta-6 is a receptor for fibronectin and cytotactin. It recognizes the…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: From the results of your BLAST search you can link to the GENE entry for one of your top hits. This…

A: I do not have access to the specific BLAST results you are referring to. However, I can provide…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus…

A: Restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence…

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: If you had the RNA sequence below: 5' UUUGGAG 3' and you were going to make a piece of DNA that…

A: DNA is a molecule discovered in the nucleus by Friedrich Meischer in the late 1860s, but its…

Q: Which reading frame gives you the longest amino acid sequence? 5'3 Frame 1 5'3 Frame 2 5'3 Frame…

A: In the world of molecular biology, understanding reading frames is crucial for deciphering genetic…

Q: 6. Use the sequences below to illustrate, construct and explain what is meant by meant by a tiling…

A: DNA extraction aids in the study of the genetic origins of different illnesses. For the development…

Q: A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram…

A: A technique for figuring out the nucleotide sequence of DNA is called Sanger sequencing, commonly…

Q: In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into…

A: Genome of an organism includes all the cellular DNA of the organism; including nuclear, chloroplast…