Below is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found.                  5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC                                             GCCACTGATCATTA–3’

Which reading frame gives you the longest amino acid sequence? 5'3 Frame 1 5'3 Frame 2 5'3 Frame 3 3'5 Frame 1 3'5 Frame 2 3'5 Frame 3

Give typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above

You are sequencing the genome of newly discovered bacterium, and know nothing of its sequence except that it is one single circular chromosome about 6,000,000 bp long. Your raw sequencing data, from two reactions, are given: 5'-ACCGTCGGTTACGCTTAGA-3' 5'-GTTACGCTTAGATAACACAAG-3' Based on this data, give the sequence of one sequence read: Based on this data, give the sequence of one sequence contig: C. So far, the researchers have assembled all the data they have into three sequence contigs. Have they sequenced the whole genome? Briefly explain, in one or two sentences.

Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?

For the following sequence please design an 18 base pair forward primer.  ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG

Give correct detailed Solution with explanation needed..don't give Handwritten answer..don't use Ai for answering this

The following DNA sequence was determined by Sanger sequencing, using a 20 nt long sequencing primer that ended ...AGTACAACAA-3'. 5'-agtacaacaa ctctcggtc tacggtacgc ctgcgggcgc gtagccaatc tagcacttcg-3' 3'-tcatgttgtt gagagccag atgccatgcg gacgcccgcg catcggttag atcgtgaagc-5′ A. If the technician forgot to add ddNTPs to the reaction, what would the sequencing chromatogram look like? Blank Many peaks, but only one at each position Overlapping peaks at every position All peaks are black There is only one peak, at 60 nt B.When the reaction is done correctly, ddCTP is labeld with a yellow fluorescent tag. When the Sanger sequencing reaction is complete, what will be the lengths, in nucleotides, of the three shortest products that have the yellow tag? C. Could you perform Illumina sequencing using ddNTPs? Why or why not? Explain.

Please don't provide handwriting solution

In a genome project, the following genomic DNA sequences were obtained. Assemble the sequences into a contig. Using the assembled sequence, perform a BLASTn search. Does the search produce sequences similar to your assembled sequence? 5’ TCGGGGTCCTGGGATCTCATCACTGCAGCGC 3’ 5’ACTGCAGCGCTTTCCCAGCGGGCGGTGGTAC 3’ 5’GGGCGGTGGTACTCGGGAAGTCAGGAGTGTT 3’ 5’AGGAGTGTTTAAAACCTGGGGACTGGTTTTG 3’ 5’TGGTTTTGGGGGCGCTGAAGGCAGCGCAGGA 3’