For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCGGUUAAGCG - 3' Second Letter UUU Phe ucU u UuC UUA UGU Cys u UGC Stop UGA Stop Stop UGG Trp G UAU Ser UAC Tyr uc UCA UcG UAA Leu UUG UAG CU c Cuc CUA CUG CU Leu CCC CCA cG CAU CÁC CAA CAG His CGU CGC Arg Pro Gin CGA 1st 3rd CGG AGU | Ser u letter AGC AGA AGG letter AAU AAC AUU ACU Asn A AUC le ACC Thr AUA ACA AAA Lys Аrg AUG Met ACG AAG GAU GAC GCU Val GCC GCA GCG GUU Asp GGU GGC Gly G GUC GUA GUG Ala GAA GGA Glu GAG GGG

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The sequence of protein is usually notated as a string of letters, according to the order of the…

Q: Please help me find the protein sequence in reference to the text below.      "mRNA Sequence…

A: Cell is the basic structural and functional unit of life. The nucleus in the cell contains the…

Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…

A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…

Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…

A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…

Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…

A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG  mRNA codon is ..…

Q: Using the genetic code, indicate which polypeptides would be synthesized if poly-UGG were used in a…

A: Polypeptides are amino acid chains that forms the various protein molecues in our body. These…

Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…

A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…

Q: Directions: Transcribe the mutated DNA sequence in the space provided. The BOLDED nitrogen bases are…

A: Condon is the trinucleotide nitrogenous bases that codes for specific amino acids and there are in…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: If a point substitution mutation changes the sequence 5'ATGAAA3' to 5'ACGAAA3' in the MIDDLE of the…

A: Point mutation is a genetic mutation in which a single nucleotide base is altered, inserted or…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: Given the following mRNA and amino acids, construct a polypeptide from this tRNA strand.…

A: This is the DNA which ultimately decides what amino acid sequences are going to be added to form a…

Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…

A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.

Q: Met – Asn – Cys – Phe – Glu – Met – Leu – Arg – Ile – Asp – Glu – Gly – Leu – Arg – Leu – Lys – Ile…

A: The central dogma of molecular biology states that it is the unique nucleotide sequence in DNA which…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: The process of gene expression involves the process of transcription followed by the process of…

Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…

A: Mutation of amino acids change the primary structure of the protein which affects the protein…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Shown below is an E. coli's DNA sequence coding for XXR protein. The nucleotides are numbered 1 to…

A: Here I will provide you first 10 nucleotides long mRNA sequences according to question.

Q: For the below sequence, where the +1 site is in bold underline and the +10 and -10 sites are also…

A: Option 1 i.e. 5' AUA 3' is the correct answer.

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…

A: The process of protein synthesis using the information in an organism's DNA is called central dogma…

Q: The following sequence is from a region of the M13 bacteriophage genome. Identify and label the…

A: Viruses do not have a living cell like other organisms. They have genetic material encapsulated…

Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA

A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…

Q: decode the following mRNA strand into the appropriate amino acid sequence (assume the first 3…

A: m-RNA undergoes translation to form proteins. The correct form of the amino acid sequence is 5’- AUG…

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…

Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…

A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…

Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…

A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: Below is an mRNA sequence for a short peptide called Lstqz. The nucleotides of the mRNA for Lstqz…

A: This mRNA sequence have so many genetic code. There are some numerical value on genetic code but all…

Q: The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are…

A: A genetic code is a table consisting of 64 codons each of which code for specific amino acids. These…

Q: 1. Below is the sequence from the 3' end of an mRNA.…

A: Genes store genetic information in the form of DNA, which may be converted into functional proteins…

Q: Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6…

A: Proteins are synthesized from mRNAs through translation. mRNAs are synthesized through…

Q: Assume that the following mRNA segment has been translated.   5’-UACCGAAUGUCU-3’   Note for…

A: Translation is the process during which codons in mRNA are identified by tRNA with specific…

Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…

A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…

A: Translation  It is the synthesis of proteins from the codons present in the mRNA. Anticodons…

Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…

A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…

A: The synthesis of proteins with the help of  m RNA is know as translation.

Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…

A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…