Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 17, Problem 7PDQ
Summary Introduction
To review:
The advantages of palindromic restriction sites in the DNA (deoxyribonucleic acid) strand.
Introduction:
Recombinant DNA technology (RDT) creates a combination of DNA segments by cutting and joining of DNA molecule from different sources. RDT is used to clone a small segment of DNA called DNA of interest. These small DNA segments are inserted into the vector for amplification of DNA molecule. DNA insert, vectors, DNA ligase, restriction enzymes, phosphatases or kinases, and host cell are the tools, which are involved in RDT. DNA strand is cleaved at the sugar-phosphate back bone by restriction enzymes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
A restriction endonuclease breaks a bacterial plasmid into sticky ends to create recombinant DNA. The same restriction endonuclease is used to cleave the DNA segments that will be added to the plasmid. What are sticky ends, and why are complementary sticky ends on the target DNA and the plasmid it will be inserted into so important?
A plasmid DNA and a linear DNA (both of the same size) have one site for
a restriction endonuclease. When cut and separated on agarose gel
electrophoresis, plasmid shows one DNA band while linear DNA shows
two fragments. Explain.
Chapter 17 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 17 -
CASE STUDY |Should we worry about recombinant DNA...Ch. 17 - Prob. 2CSCh. 17 - Prob. 3CSCh. 17 -
HOW DO WE KNOW?
1. In this chapter we focused on...Ch. 17 - Prob. 2PDQCh. 17 - What roles do restriction enzymes, vectors, and...Ch. 17 - Prob. 4PDQCh. 17 - Prob. 5PDQCh. 17 - Prob. 6PDQCh. 17 - Prob. 7PDQ
Ch. 17 - List the advantages and disadvantages of using...Ch. 17 - What are the advantages of using a restriction...Ch. 17 - The introduction of genes into plants is a common...Ch. 17 - Prob. 11PDQCh. 17 - Prob. 12PDQCh. 17 - Prob. 13PDQCh. 17 - What advantages do cDNA libraries provide over...Ch. 17 - Prob. 15PDQCh. 17 -
16. List the steps involved in screening a...Ch. 17 -
17. In a typical PCR reaction, describe what is...Ch. 17 -
18. We usually think of enzymes as being most...Ch. 17 - How are dideoxynucleotides (ddNTPs) structurally...Ch. 17 - Prob. 20PDQCh. 17 - One complication of making a transgenic animal is...Ch. 17 -
22. When disrupting a mouse gene by knockout, why...Ch. 17 - Prob. 23PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forwardRestriction endonuclease and ligase are two types of enzymes used in the process of genetic engineering, i.e., the manipulation of genes. The restriction endonuclease differs from ligase in that it breaks the DNA at ends, while ligase causes the breaks in DNA from interior joins the fragments of DNA, while ligase breaks the DNA into fragments breaks the DNA at specific points, while the ligase joins the fragments of DNA breaks the DNA apart at each nucleotide, while ligase use the pieces to translatearrow_forwardSome restriction endonucleases produce blunt-ended pieces of DNA, while other produce DNA fragments with sticky ends. What is the difference? What type of ends do AatII and DraI produce?arrow_forward
- How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if the recognition sequence for the enzyme had 5 bp? (Assume that the four types of bases are equally likely to be found in the DNA and that the bases in a recognition sequence are independent.) How often would the endonuclease cut the DNA if the recognition sequence had 8 bp?arrow_forwardAfter restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAarrow_forwardFor a restriction enzyme that recognizes the restriction site GGCC, Which of the following statements is/are true?arrow_forward
- In the formation of recombinant DNA, a restriction endonuclease cuts a bacterial plasmid to give sticky ends. The DNA segments that are to be added to the plasmid are cleaved with the same restriction endonuclease. What aresticky ends and why is it important that the target DNA and the plasmid it will be incorporated into have complementary sticky ends?arrow_forwardA) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involvedarrow_forwardRestriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forward
- What are the three types of DNA ends that can be generated after cutting DNA with restriction enzymes? What reaction is catalyzed by DNA ligase?arrow_forwardWhen circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed position on the DNA, all the way around, usually in a clockwise manner. a DNA molecule that is 3133 base pairs long is digested with RsaI restriction enzyme recognition sites at base numbers 366, 1534, and 2207. What are the sizes of the DNA fragments that will be produced after the DNA is digested with RsaI?arrow_forwardThere are three classes of restriction enzymes; Class I, Class II and Class II. Nevertheless, Class II is most popular in recombinant technology. Explain the reason behind this.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY