Concept explainers
To review:
A plasmid having a restriction site for Hind III enzyme within a kanamycin resistance gene was cleaved with Hind III and was re-ligated. It was used to transform E.coli (Escherichia coli) K12 cells. From the culture plate, kanamycin resistant colonies were selected and electrophoresis of the plasmid DNA from these colonies was carried out. Most of the colonies with plasmid produce a single band, which migrated at the same speed as the original intact plasmid. A slow band in agarose gel electrophoresis was obtained as a product of ligation.
Introduction:
Agarose gel electrophoresis is standard lab procedure for a DNA (deoxyribonucleic acid) separation on the basis of size (length in base pair). Agarose gel electrophoresis uses an electrical field to mobilize negatively charged DNA molecule in an agarose gel matrix toward the positively charged electrode. A DNA molecule, when digested with restriction enzymes (tools of recombinant DNA technology or RDT), produces the bands of different sizes when subjected to electrophoresis. This technique is used for diagnostic purposes to determine the genetic defects.
Want to see the full answer?
Check out a sample textbook solutionChapter 17 Solutions
Essentials of Genetics (9th Edition) - Standalone book
- After transformation you were asked to grow bacterial cells transformed with plasmid on a plate that had X-gal and ampicillin. X-Gal is often used as in indicator dye, which turns blue when metabolized by B-galactosidase protein and used to test if cloning experiments have worked. [Note look at the vector diagrams carefully] Briefly explain how you would find the bacterial cells that are transformed with the plasmid with the YFG inserted.arrow_forwardYou have just carried out a transformation using a plasmid (possessing a Amp-resistance gene) that was 0.001 ug/ul in concentration. You added 10 ul of this plasmid to 100 ul of a bacterial cell suspension. Then you added 250 ul of LB following heat shock. After plating 200 ul of this cell suspension with LB onto a LBA plate, you observe 8 colonies on this plate. What is the transformation efficiency of this plasmid (in colonies/ug of plasmid) based on these results? about 1400 O about 80O about 4000 O about 400O O about 8000 f6 米 IO fs fg f1o 19 08. O OOarrow_forwardA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: Which antibiotic should be added to the mediumto select cells that have incorporated a plasmid?arrow_forward
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardTo determine if the antibiotic resistance in MH1 was carried on a plasmid, you first isolate the plasmid in MH1 using the plasmid DNA purification technique. Then, you transform bacteria that are not resistant to penicillin/ampicillin with the plasmid isolated from MH1. For the bacterial transformation experiment, you set up the three controls listed below. Match each control with its appropriate purpose (i.e. what it is controlling for) Please note: Transformed bacteria are bacteria that received the plasmid from MH1 and untransformed bacteria are bacteria that did not receive a plasmid. Testing to ensure that the bacteria used in the transformation experiment are viable (i.e. can grow on LB media) (Choose) [ Choose ) after transformation. Untransformed bacteria plated on LB only plate Testing to ensure that the bacteria used in the transformation experiment are viable (ie. can grow on LB media) before transformation. Transformed bacteria plated on LB only plate Untransformed bacteria…arrow_forwardThe gene atg-12 codes for a protein associated with abnormal rates of cell destruction and recycling of cell contents. Scientists studying bacterial plasmids devised an experiment using recombinant DNA techniques to remove a section of DNA (gene atg-12) of a bacterial plasmid (pOKE103) and create a new plasmid (pOKE104) that did not contain the gene atg-12. The new plasmid was then incorporated within the DNA of the fungus Neurospora crassa in cellular studies. Which statement explains the expected heredity of fungi that incorporate pOKE104? A - Fungi that incorporate pOKE104 will produce the protein from gene atg-12 and have increased rates of malignant tumors. B - Fungi that incorporate pOKE104 will not produce the protein from gene atg-12 but will have a normal appearance. C - The prokaryotic DNA will remain separate within the fungal cells, produce the protein from gene atg-12, and have increased rates of malignant tumors. D - The prokaryotic DNA will remain separate within the…arrow_forward
- Bacterial plasmids often serve as cloning vectors. Describe the essential features of a plasmid vector.arrow_forwardA plasmid that is both ampicillin and tetracyclineresistant is cleaved with PstI, which cleaves within theampicillin resistance gene. The cut plasmid is ligated withPstI-digested Drosophila DNA to prepare a genomic library,and the mixture is used to transform E. coli K12. Question: How can you explain the presence of colonies thatare resistant to both antibiotics?arrow_forwardA shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEp), Yeast Integrating Plasmid (YIp) and Yeast Replicating Plasmid (YRp). Among these three vectors, YIp has the lowest transformation frequency and copy number per cell. Explain why Ylp is still popularly used despite its limitations.arrow_forward
- You are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E+H E+X H+x Kb +4.3 +2.8 -+2.5 -2.0 - -1.8 +1.5 -1.0 12 F0.8 +0.5 a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?arrow_forwardA plasmid, pUC18, contains the ampicillin-resistance gene, the origin of replication, and the ß - gal gene, which codes for the B-galactosidase protein. This protein can break down the synthetic chemical X-gal, producing a blue product that stains the entire cell blue (but is harmless to the bacteria). At the beginning of the B-gal gene there are several unique restriction sites (some of them are shown in the diagram below). You wish to clone a 1.0-kb Xbal fragment into the pUC18 plasmid, so you cut the plasmid with Xbal and, after removing the enzyme, mix the Xbal-cut plasmid with the 1.0-kb fragment, ligate, and transform competent bacteria. Pati Xbal EcoRI B-gal A Amp ori Figure: pUC18 plasmid map (a) On what medium would you grow your transformed bacteria? (b) Do you expect the bacteria carrying plasmid pUC18 (without the insert) to be blue or white when grown in the presence of X-gal? Explain.arrow_forwardFor protein expression, a different strain of Coli is being employed than the one used for plasmid DNA expression. You disinfect your bench in advance of transforming the plasmid into the other cell line after completing the miniprep to isolate the plasmid. After the transformation is finished, you place the two samples in the freezer. You discover two separate tubes with the labels A and B when you try to get the cells for use. You decide to label your samples more accurately the following time. Since it costs a lot to buy competent cells, you design an experiment to find out what kind of cells are in each tube. Give an example of an experiment you could do to identify the cells using the equipment in our lab. Here, cloning is not an option. Small explanation with citation pleasearrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education