Essentials of Genetics (9th Edition) - Standalone book
9th Edition
ISBN: 9780134047799
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 17, Problem 6PDQ
Summary Introduction
To review:
The palindromic recognition sequence in
Introduction:
The deliberate change (modifications) in the genetic material of an organism by altering the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
(i) Which of the DNA sequences shown below can be cut by using restriction enzyme?
Explain your answer by analysing the sequences.
Sequence A: 5'-AATGGCTGCCGTGGCTTA-3'
Sequence B: 5'-TAACCCTGCGCATTTGCA-3'
(ii) Given a DNA sequence, 5'-TACGAATTCGTAA-3' and EcoRI cutting site as below.
Write out the double stranded fragments that are generated when EcoRI works on this
DNA sequence.
EcoR I
5.. GAATTC...3'
3...CTTAAG...5'
Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these restriction enzymes have cleaved the DNA, four of them produce sticky ends that can hydrogen bond with complementary sticky ends, as shown in Figure 21.1. The efficiency of sticky ends binding together depends on the number of hydrogen bonds; more hydrogen bonds makes the ends “stickier” and more likely to stay attached. Rank these four restriction enzymes from Table 21.3 (from best to worst)with regard to the efficiency of their sticky ends binding to each other.
Chapter 17 Solutions
Essentials of Genetics (9th Edition) - Standalone book
Ch. 17 -
CASE STUDY |Should we worry about recombinant DNA...Ch. 17 - Prob. 2CSCh. 17 - Prob. 3CSCh. 17 -
HOW DO WE KNOW?
1. In this chapter we focused on...Ch. 17 - Prob. 2PDQCh. 17 - What roles do restriction enzymes, vectors, and...Ch. 17 - Prob. 4PDQCh. 17 - Prob. 5PDQCh. 17 - Prob. 6PDQCh. 17 - Prob. 7PDQ
Ch. 17 - List the advantages and disadvantages of using...Ch. 17 - What are the advantages of using a restriction...Ch. 17 - The introduction of genes into plants is a common...Ch. 17 - Prob. 11PDQCh. 17 - Prob. 12PDQCh. 17 - Prob. 13PDQCh. 17 - What advantages do cDNA libraries provide over...Ch. 17 - Prob. 15PDQCh. 17 -
16. List the steps involved in screening a...Ch. 17 -
17. In a typical PCR reaction, describe what is...Ch. 17 -
18. We usually think of enzymes as being most...Ch. 17 - How are dideoxynucleotides (ddNTPs) structurally...Ch. 17 - Prob. 20PDQCh. 17 - One complication of making a transgenic animal is...Ch. 17 -
22. When disrupting a mouse gene by knockout, why...Ch. 17 - Prob. 23PDQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Assume that a plasmid is 4700 base pairs in length and has restriction sites for a given restriction enzyme at the following locations: 800, 1400, 2900, and 3600. List the fragments by size that are ! expected when the plasmid is fully digested the restriction enzyme.arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forwardYou are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E+H E+X H+x Kb +4.3 +2.8 -+2.5 -2.0 - -1.8 +1.5 -1.0 12 F0.8 +0.5 a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?arrow_forward
- The map of plasmid pUC19 is shown below. The restriction site coordinate is the position of the 5’base on the top strand of each site sequence. The restriction enzyme sites are in bold type if there is only one site in pUC19. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme PvuII. Please list the fragments in order of size, largest to smallest, which will result from a complete digestion by the restriction enzyme DrdI.arrow_forwardA small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forwardGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forward
- A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.arrow_forwardA plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA band while linear DNA shows two fragments. Explain.arrow_forwardThe gene you are asked to clone is 30,000 bps in length. When you are choosing a suitable Restriction Endonuclease, what criteria about the enzyme can you deduce from the gene length?arrow_forward
- See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut using three restriction enzymes, namely Kpnl, Sall and EcoRI, it yields four fragments with sizes of 390 bR. 810 bp, 270 bp www and 330 bp. Kpnl Sall EcoRI 390 810 270 330 1800 bp 1. If you were to subject this digested DNA to agarose gel electrophoresis, what would your gel look like? Draw a detailed picture of your gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. 2. You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exac fragment sizes are not important.arrow_forwardRestriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forwardBelow is a diagram of the vector you are planning to use. You identify four restriction enzyme recognition sites in the vector as indicated in the diagram below. The distance between the restriction sites are indicated by numbers (in kilo base pairs). ori ВатHI ВатHI 2 ЕcoRI Kpnl If you digest the vector with a combination of EcoRI and BamHI and run the resulting DNA fragments on a gel, which lane would represent the expected result? (Lane 1 contains the DNA size marker.) А В с (kbp) 8 Promoterarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License