What are the three types of DNA ends that can be generated after cutting DNA with restriction enzymes? What reaction is catalyzed by DNA ligase?

Q: In pcr experiment, Does electrophoresis show that only DNA products of the desired size are present?…

A: A DNA sequence may be amplified trillions of times via PCR, yielding enough DNA copies for further…

Q: This plasmid was digested using different restriction enzymes whose sites have been mapped. The…

A: Note: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question…

Q: What difficulties arise in the polymerase chain reaction if there is contamination of the DNA that…

A: Deoxyribonucleic acid or DNA is a nucleic acid that composed of two polynucleotide chain that is…

Q: Using nucleotide letters, show the kind of cut that could be made on a DNA molecule to circularize…

A: A plasmid is a small, extrachromosomal DNA molecule within a cell that is different from the…

Q: A geneticist is interested in determining the locations of methylated cytosines within a fragment of…

A: A geneticist is a person who analyze the genomic profiling expression and the pedigree analysis of a…

Q: What bacteria were used for the isolation of the three enzymes (HindIII, NdeI and PvuI)? What type…

A: HindIII  is isolated from Haemophilus influenzae . NdeI is an  isolated from Neisseria…

Q: recombinant plasmid

A: DNA is the material that carries all the information about how a living thing will look and…

Q: What is the procedure to extract DNA through banana?

A: DNA (deoxyribonucleic acid) is the genetic material of the cell. It is double stranded and is made…

Q: DEFINE THE FOLLOWING: 1) restriction enzyme 2) plasmid 3) recombinant DNA

A: Ans 1) Restriction enzymes are enzymes that are isolated from bacteria that can cleave…

Q: Although many cloning applications involve introducing recombinant DNA into bacterial host cells,…

A: Cloning can be defined as the process by which identical copies of the organisms are created. More…

Q: PCR uses two short DNA sequences (the primers) that bind to the two DNA strands of the original…

A: DNA replication is a complex process of producing copies of the entire chromosome using the…

Q: How would the results of this activity have been different if the DNA sequence you digested were…

A: Gel electrophoresis is a process in which DNA fragments are separated on the basis of their size.…

Q: What are the disadvantages of doing DNA sequencing?

A: DNA sequencing is a process of identifying the order of nucleic acid bases i.e. adenine, guanine,…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: What is a restriction enzyme? How can restriction enzymes be used to splice a piece of human DNA…

A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…

Q: A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease.…

A: Because plasmid is a circular DNA molecule, this is the case. It becomes linear but not fragmented…

Q: Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each…

A: Restriction enzymes (RE) are the enzymes that recognize and cut specific sequences of DNA called…

Q: What is recombinant DNA? How can it be used to produce human proteins in bacteria?

A: Recombinant DNA: Recombinant DNA is produced by combining DNA segments that doesn't normally occur…

Q: complimentary sticky ends

A: DNA's are cut by using restriction enzymes ( endonuclease or exonuclease) which produce sticky or…

Q: There are three classes of restriction enzymes; Class I, Class II and Class II. Nevertheless, Class…

A: Restriction endonuclease are the enzyme which make a cut in genetic material that is DNA somewhere…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…

A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…

Q: The following question is related to Restriction Enzymes and RFLP. Using EcoRl, how many fragments…

A: Restriction enzymes are enzymes that cleave DNA. Each enzyme identifies and chops DNA at or near one…

Q: What is the function of a restriction enzyme?

A: Restriction enzymes are enzymes that are isolated from bacteria that can cleave single-stranded or…

Q: How is DNA amplified in a polymerase chain reaction(PCR) procedure?

A: Step 1 Polymerase chain reaction (PCR) sometimes also called molecular photocopying is a technique…

Q: It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: Why was it necessary to mash the strawberries extensively with your hands? (hint: you wouldn’t have…

A: This is the process that is used for the extraction of DNA from the cell. DNA is present in the…

Q: What is a restriction digest? What does it mean if you were given a precut DNA?

A: Restriction enzyme digestion takes advantage of naturally occurring enzymes that cleave DNA at…

Q: Why do alcohol and water separate in DNA extraction process?

A: DNA extraction is defined as a process that is used widely for carrying out the purification fo DNA.…

Q: During PCR amplification in preparation for DNA sequencing, why were there different colors at the…

A: Polymerase chain reaction is a process by which millions of copies of a specific DNA segment are…

Q: Assume that a plasmid is 4700 base pairs in length and has restriction sites for a given restriction…

A: A circular piece of DNA has four sites for a particular restriction enzyme, then that restriction…

Q: What is the role of a primer in DNA replication? What would happen if you forgot to add a primer in…

A: DNA replication is the process in which a parent DNA is separated and two new strands are formed…

Q: How did Taq DNA polymerase acquire its name?

A: Taq DNA polymerase is widely used in molecular biology studies and experiments. It is a DNA…

Q: What is the enzyme responsible for methylating DNA? How does a drug like doxorubicin affect DNA…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: In the formation of recombinant DNA, a restriction endonuclease cuts a bacterial plasmid to give…

A: Recombinant DNA is a type of genetically engineered DNA which is produced to combine the best…

Q: What are DNA ligases? Howdo these enzymes participatein the recombinant DNAtechnology?

A: Recombinant DNA (rDNA) technology alters the phenotype of the host by introducing the modified…

Q: How many copies of a target DNA molecule are made after 30 cycles of PCR?

A: The polymerase chain reaction is a widely used technique for the amplification of DNA. Here, the…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.