The type of tissue in which CpG (Cytosine and Guanine linked by phosphodiester bond) island is methylated and its correlation with the function of protein encoded by gene T (Transporter). Introduction: Restriction enzymes cleaveparticular DNA (Deoxyribonucleic acid) sequence and there are different types of restriction enzymes based on the sequence of DNA (Deoxyribonucleic acid) they cleave. It includes BamHI ( Bacillus amyloliquefaciens strain H), EcoRI ( Escherichia coli RY13), NotI ( Nocardia otitidis ), SalI ( Streptomyces albus ). NotI is used for investigating the presence of CpG island near the gene T which codes for a transporter protein and it is involved in the process of uptake of phosphate from soil. NotI will not cleave the DNA which is methylated. A CpG island is found near the promoter for T gene. The other two restriction sites present near the T gene are the SalI restriction sites which are present upstream from the CpG island and EcoRI site, which are present near the end of the gene T (Transporter).

Question

Want to see the full answer?

Answer 1

Question

Chapter 15, Problem 3EQ

Summary Introduction

To review:

The type of tissue in which CpG (Cytosine and Guanine linked by phosphodiester bond) island is methylated and its correlation with the function of protein encoded by gene T (Transporter).

Introduction:

Restriction enzymes cleaveparticular DNA (Deoxyribonucleic acid) sequence and there are different types of restriction enzymes based on the sequence of DNA (Deoxyribonucleic acid) they cleave. It includes BamHI (Bacillus amyloliquefaciens strain H), EcoRI (Escherichia coli RY13), NotI (Nocardia otitidis), SalI (Streptomyces albus).

NotI is used for investigating the presence of CpG island near the gene T which codes for a transporter protein and it is involved in the process of uptake of phosphate from soil. NotI will not cleave the DNA which is methylated. A CpG island is found near the promoter for T gene. The other two restriction sites present near the T gene are the SalI restriction sites which are present upstream from the CpG island and EcoRI site, which are present near the end of the gene T (Transporter).

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above

The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.

Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.