Genetics: Analysis and Principles
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 12, Problem 1EQ
Summary Introduction

To review:

The position of the intron in the genomic DNA (deoxyribonucleic acid), and the identification of the normal consensus sequence for splicing. Also, the identification of the splice site sequence.

Introduction:

The cDNA (complementary DNA) is the DNA which is made from the single-stranded RNA (ribonucleic acid). The cDNA is used for the cloning of the eukaryotic genes in the given prokaryotes. Genomic DNA is the chromosomal DNA which helps to form the hereditary material which is passed from one generation to the next. The introns are the sequences which are removed by the splicing of the premature RNA.

Blurred answer
Students have asked these similar questions
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS   5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’   Answer the following questions:   Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.
The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS   5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt   What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AA
The double stranded DNA sequence shown contains the promoter for the transcription of a bacterial gene. GGCACCTGCGATGCATGAATATATCGATCGGGAATCGCTATGTCAAGCCATGGCTAGATTA CCGTGGACGCTACGTACTTATATAGCTAGCCCTTAGCGATACAGTTCGGTACCGATCTAAT Draw a box around each of the promoter elements and identify each. Identify which strand will be used as the template strand by putting a vertical line between the -1/+1 start site nucleotides and underlining in the direction of transcription on the template strand as the example below indicates. ATCGG\GAATCGC TAGCCCTTAGCG Give the sequence of the RNA created

Chapter 12 Solutions

Genetics: Analysis and Principles

Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY