Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 12, Problem 11CONQ
Summary Introduction
To review:
How DNA mutations can cause a change in the binding site of the σ- factor. And, how the specific base changes can cause a change in the sequence and inhibit the binding of the σ- factor.
Introduction:
DNA (deoxyribonucleic acid) mutations are mutations which are caused in the DNA due to changes in the base pairs or due to a shift in the base substitutions. This will affect RNA strand formation because the transcription rate is affected. The holoenzyme of RNA would not be moved to the remaining part of the DNA strand due to mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the
potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1
is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying
particular residues).
a helix #1
R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16)
#1
Predict the consequence of the following
mutations:
1) Arg(1) to Glu
2) Arg(1) to Ala
3) Phe(6) to lle
4) Trp(7) to Phe
5) Met(9) to Pro
in
In bacteria, researchers have isolated strains that carry mutations within tRNA genes. These mutations can change the sequence of the anticodon. For example, a normal tRNATrp gene encodes a tRNA with the anticodon 3′–ACC–5′. A mutation can change this sequence to 3′–CCC–5′. When this mutation occurs, the tRNA still carries a tryptophan at its 3′ acceptor stem, even though the anticodon sequence has been altered.
A. How would this mutation affect the synthesis of polypeptides within the bacterium?
B. What does this mutation tell you about the recognition between tryptophanyl-tRNA synthetase and tRNATrp? Does the enzyme primarily recognize the anticodon or not?
The alpha chain of human hemoglobin has 141 amino acids in a single polypeptide chain. Calculate the minimum number of bases on DNA necessary to code for the alpha chain. Include in your calculation the bases necessary for specifying termination of polypeptide synthesis.
Chapter 12 Solutions
Genetics: Analysis and Principles
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Christian Anfinsen showed that the enzyme Ribonuclease (RNase) is completely inactivated at high concentrations of beta mercaptoethanol (BME). When BME is removed, it restores only approximately 1% of RNase activity. When a very low concentration of BME is added back to RNase, its activity is restored to nearly 100%. Why? a Low concentrations of BME causes disulfide bonds to break, but they randomly reform. b High concentrations of BME disrupt all disulfide bonds, which inactivates the enzyme. At low concentrations all of the disulfide bonds reform and BME acts as a cofactor for the enzyme. c The enzyme is only active when an intermediate number of disulfide bonds exists. which is achieved only at low concentrations of BME. d The low concentration of BME allows the majority of the proteins to adopt their most stable form, which is the active form.arrow_forwardConsider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?arrow_forwardConsider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forward
- A segment of the wild type of DNA sequence coding for the site of N501 mutation is shown below. TGTTGGCTACTAATGGCTATCATCACACGC… identify the correct reading frame, the amino acid sequence in a single letter code, and the charged residues and approximate net charge for this portion of the protein at pH 8 Given the location and type of the mutation, why would scientists potentially be concerned about this variant?arrow_forwardThe following diagram illustrates a step in the process of translation. Identify the following elements on the diagram. a. A, P, and E sitesarrow_forwardThe tRNA anticodon sequence 3’GAG 5’ is charged with the amino acid leucine. This anticodon may pair with both 5’ CUC 3’ and 5’ CUU 3’. Which of the following is consistent with this phenomenon? 1. The information provided is not accurate since only the 5’ CUC 3’ codon can complementary base pair with the 3’ GAG 5’ anticodon 2. This feature allows for the genetic code to be degenerate 3. This feature allows for the genetic code to be overlapping 4. This feature is commonly associated with tautomeric shifts 5. This feature causes a change in the encoded amino acidarrow_forward
- Imagine that you repeat the tRNA Selection experiment with modifications as follows: 1. Synthesize mRNA containing A's and G's only (poly-AG in random order). 2. Convert the amino acid Glutamic acid (Glu) on its tRNA to the amino acid Glutamine (Gln) as shown below. 3. Mix your poly-AG RNA, your artificial tRNA, and cell extract (contains ribosomes, amino acids, all normal tRNAs, and the energy source for translation). Phe Tyr GAA GAA Glutamic acid (Glu) is encoded by GAA and GAG, while Glutamine (Gln) is encoded only by CAA and CAG. What does the outcome of this experiment tell us about translation? Multiple codons code for each amino acid. An amino acid is selected based on the identity of the tRNA. The ribosome does the translation, i.e. it selects the amino acid regardless of the identify of the tRNA. The ribosome reads mRNA 3 bases at a time.arrow_forwardThe E coli cell contains 107 non-specific DNA binding sites for R, 10 R molecules, and 1 Operator. And the mechanism of specific binding of R to O works well with these concentrations. Would it work if R = 1? Explain with a calculation.arrow_forward(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helixarrow_forward
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forward1. (a) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to sup- press synthesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix - reverse turn - helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein. A diagram of the trp repressor dimer is also shown. Trp Prl Trp Prl 80 -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly-Ile- -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr-Val- trp helix 5 70 trp helix 4 Prl helix 80 Prl helix Ala-Thr-Ile-Thr-Arg-Gly-Ser-Asn-Ser-Leu-Lys-Ala-Ala- Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- reverse turn 90 Comparing the two protein sequences above, identify all amino acid pairs that differ in electrostatic charge due to proton dissociable groups (assume pH 7). Indicate the charge of both residues for each such pair. (b) Circle the pair of residues for which the electrostatic charge due to…arrow_forwardThe charging of a tRNA with an amino acid can be represented by the following equation:amino acid + tRNA + ATP → aminoacyl-tRNA + AMP + PPI where PPI is pyrophosphate (see figure 3–40). in the aminoacyl-tRNA, the amino acid and tRNA are linked with a high-energy covalent bond; a large portion of the energy derived from the hydrolysis of ATP is thus stored in this bond and is available to drive peptide bond formation at the later stages of protein synthesis. the free-energy change of the charging reaction shown in the equation is close to zero and therefore would not be expected to favor attachment of the amino acid to tRNA. Can you suggest a further step that could drive the reaction to completion?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY