TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT

Q: Watch the following video called "Human Genome Project Video"…

A: Decoding the human genome has provided a wealth of information that is revolutionizing medicine,…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: You would like to use a CRISPR-Cas system to knockout a gene that includes the following sequence:…

A: CRISPR (Clustered regularly interspaced short palindromic repeats)-Cas is a gene-editing tool. It…

Q: Your graduate advisor asks you to amplify the following sequence of DNA by PCR:…

A: The primer should be complementary to the region of template to be amplified.

Q: please answer the question provided in the picture about the black allele gene asap please

A: INTRODUCTION Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: Given sequence of EboV strain 1 is CTA TGC AAG CAG TTA and strian 2 is TCA TGT CAG CAA CTA.

Q: The target sequence for a PCR amplification is shown below. When the final cycle of PCR has ended,…

A: The polymerase chain reaction (PCR), often known as "molecular photocopying," is a rapid and…

Q: Based on these sequences, how do you decide decided which fragments were the beginning, middle, and…

A: There are three fragments given in the question. The three fragments can be aligned on the basis of…

Q: 2) The partial coding sequence of the Spike protein for SARS- COV-2 is shown below: You are tasked…

A: The answer is option A  In the PCR amplification, two primers are used to flank the target region to…

Q: For the chromatogram below, what is the sequence of the template DNA from base 115 to 125?…

A: According to the question, we have to answer the question that which is for the chromatograph below,…

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: The sequence at one end of one strand of the Drosophilatransposon Mariner is shown below (dots…

A: The genes are the sequence of nucleotides that are present on the chromosomes and encode for a…

Q: What will be the mRNA produced from the given template? DNA Template 3 - ATTGCGGATGCCCGTATACG -5 DNA…

A: There are two types of nucleic acids, DNA and RNA. Nucleotides are the building blocks of nucleic…

Q: Write the base sequence of the DNA template from which this RNA sequence was derived: UGUUACGGA. How…

A: Transcription  Cellular process in which RNA is synthesized using DNA as a template known as…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: Bacteriophage T7 encodes its own DNA polymerase, gp5, which has both polymerase activity and…

A: In the given graphs, the polymerase activity and exonuclease activity of DNA polymerase, gp5 is…

Q: The most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant.…

A: 5’ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’…

Q: How would you write out the sequence for the FORWARD primer if you needed to purchase it for use in…

A: When designing a forward primer for PCR, it is essential to write the sequence in the 5' to 3'…

Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…

A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Q: Select two primers from the list below such that your selected primers create a pair capable of…

A: Primer is a short strand of nucleotide sequence which helps in synthesis of DNA. After the…

Q: The figure below depicts the start of the CDNA sequence of the gene AGAMOUS from the model plant…

A: Central dogma was proposed by Francis Crick. The RNA is formed from DNA with the help of enzyme RNA…

Q: be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify…

A: Polymerase chain reaction, or  as we say PCR, is a technique used to make many copies of a specific…

Q: D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key…

A: The self replicating biomolecules that are present in the chromosomes and carry genetic information…

Q: Coding With the given coding strand perform the following 1. supply the correct non- coding strand…

A: DNA is a double helical molecule.

Q: Consider the following four DNA sequences taken from the a homologous gene from four different…

A: Multiple sequence alignment is majorly used to find out evolutionary relationship between…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: A mutation is a change in a DNA sequence. Mutations can result from DNA copying mistakes made during…

Q: How would you write out the sequence for the REVERSE primer if you needed to purchase it for use in…

A: The reason we write the reverse primer sequence in the reverse complement form is to ensure that it…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the…

A: Restriction endonucleases cut double stranded DNA at specific site or near specific site and form…

Q: Suppose you have to design two PCR primers, 16 bases in length, to amplify the whole of the 100 bp…

A: Primers are short nucleic acid molecule, that are single stranded in nature and area prerequisite…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: The following are DNA sequences from two homologous genes:…

A: Homology is an idea of finding evolutionary lineage. Homology is deduced when two Deoxyribose…

Q: Transcribe an mRNA sequence from this TEMPLATE STRAND of DNA 3' CGTACGTGTATCCCATCC 5' 5'…

A: Translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: The recombinant DNA technology use plasmid to transfer foreign DNA into the host organism in which…

Q: How many base substitutions are there between these sequences? Count ONLY the instances where there…

A: Sequence alignment involves the comparison of sequences of a particular gene from various organisms…

Q: The sequence shown in Figure 2 is the nucleotide sequence of a heat shock protein of Bacillus…

A: For the purpose of figuring out a gene's or protein's properties and function, nucleotide sequence…

Q: For the DNA sequence shown, indicate the products of its cleavage with the following restriction…

A: In the field of molecular biology and genetic engineering, restriction enzymes, commonly referred to…

Q: The sequence of a segment of mRNA, beginning withthe initiation codon, is given here, along with the…

A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…

Q: Ehat  primer sets could be amplify the following DNA sequence?   AATACGTCGCATGGggatccttttttatgcatg

A: Amplification of DNA sequence is done by the polymerase chain reaction. With the help of DNA…

Q: Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the…

A: The method of identifying the nucleotide code - the sequence of base sequence – is known as DNA…

Q: Write the sequences of the two 12-residue primers that could be used to amplify the following DNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…