Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 12CONQ
What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence:
5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′
What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following DNA nucleotides are found near the end of a bacterial transcription unit.
3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′
Q. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
Consider the Rho-dependent terminator sequence
5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription?
Group of answer choices
Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds.
Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination.
Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
This is a double-stranded DNA sequence—with no introns—that codes for a small protein (this is a hypothetical example: real genes are much longer and have introns). Transcription begins at the Transcription Start Site, which is the G/C base pair indicated by “TSS” and gold shading. Transcription stops at the A/T base pair marked with the arrow. (shown in image 1)
1)Which strand is the template strand for transcription?
a)top
b) bottom
2)What elements allowed you to identify the template strand? (Select all that apply)
a)An ATG toward the 5' end ("upstream"} from the TSS
b)The template strand has the 3' end on the left side.
c) An ATG toward the 3' ("downstream") from the TSS
d) The template strand is "read" by the polymerase from its 3' to 5' end.
3)What is the sequence of the mRNA transcribed from this gene?
a) 5’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA3’
b) 5’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU3’
c) 3’GACAGACGAUGACAUCAUGCAAAUAAGAAUUUA5’
d) 3’CUGUCUGCUACUGUAGUACGUUUAUUCUUAAAU5’
4) Write the…
Chapter 12 Solutions
Genetics: Analysis and Principles
Ch. 12.1 - 1. Which of the following base sequences is used...Ch. 12.1 - Prob. 2COMQCh. 12.2 - With regard to a promoter, a transcriptional start...Ch. 12.2 - Prob. 2COMQCh. 12.2 - 3. Sigma factor is needed during which stage(s) of...Ch. 12.2 - A uracil-rich sequence occurs at the end of the...Ch. 12.3 - Which RNA polymerase in eukaryotes is responsible...Ch. 12.3 - Prob. 2COMQCh. 12.3 - Prob. 3COMQCh. 12.3 - Prob. 4COMQ
Ch. 12.4 - Which of the following are examples of RNA...Ch. 12.4 - A ribozyme is a. a complex between RNA and a...Ch. 12.4 - Prob. 3COMQCh. 12.4 - Prob. 4COMQCh. 12.5 - 1. Which of the following is not a key difference...Ch. 12 - Prob. 1CONQCh. 12 - Prob. 2CONQCh. 12 - Prob. 3CONQCh. 12 - Prob. 4CONQCh. 12 - 5. Mutations in bacterial promoters may increase...Ch. 12 - Prob. 6CONQCh. 12 - 7. In Chapter 9, we considered the dimensions of...Ch. 12 - 8. A mutation within a gene sequence changes the...Ch. 12 - Prob. 9CONQCh. 12 - At the molecular level, describe how factor...Ch. 12 - Prob. 11CONQCh. 12 - What is the complementarity rule that governs the...Ch. 12 - 13. Describe the movement of the open complex...Ch. 12 - 14. Describe what happens to the chemical bonding...Ch. 12 - Prob. 15CONQCh. 12 - Prob. 16CONQCh. 12 - Prob. 17CONQCh. 12 - Mutations that occur at the end of a gene may...Ch. 12 - If the following RNA polymerases were missing from...Ch. 12 - 20. What sequence elements are found within the...Ch. 12 - 21. For each of the following transcription...Ch. 12 - 22. Describe the allosteric and torpedo models for...Ch. 12 - Which eukaryotic transcription factor(s) shown in...Ch. 12 - 24. The initiation phase of eukaryotic...Ch. 12 - A eukaryotic protein-encoding gene contains two...Ch. 12 - 26. Describe the processing events that occur...Ch. 12 - Prob. 27CONQCh. 12 - Prob. 28CONQCh. 12 - Prob. 29CONQCh. 12 - Prob. 30CONQCh. 12 - 31. In eukaryotes, what types of modifications...Ch. 12 - Prob. 32CONQCh. 12 - Prob. 33CONQCh. 12 - 34. Figure 12.21 shows the products of alternative...Ch. 12 - 35. The processing of ribosomal RNA in eukaryotes...Ch. 12 - Prob. 36CONQCh. 12 - Prob. 37CONQCh. 12 - After the intron (which is in a lariat...Ch. 12 - Prob. 1EQCh. 12 - 2. Chapter 21 describes a technique known as...Ch. 12 - Prob. 3EQCh. 12 - As described in Chapter 21 and in experimental...Ch. 12 - Prob. 5EQCh. 12 - Prob. 6EQCh. 12 - 1. Based on your knowledge of introns and pre-mRNA...Ch. 12 - Discuss the types of RNA transcripts and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forwardTay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To make the Hex A protein: The promoter and transcription termination sites are 33,000 base pairs apart. The Hex A protein has 600 amino acids 5’ and 3’ UTR’s are each 500 bp long. a)How many base pairs would you expect in the final mRNA? Show your work b)How many bases were spliced out? Show your workarrow_forwardHere is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forward
- What is an Okazaki fragment, and how are they later “glued” together? What are the types and major functions for each type of RNA? Define transcription and translation. Which process occurs first to make protein from DNA? In what direction does a polymerase move when synthesizing a strand of mRNA? What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?arrow_forwardShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. Question 6: How many amino acids are present in the wild-type human B-globin protein? = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription 3' 5' ATG 50 TẠC TAA 126 132 |ATT 90 130 222 850 3 5' Start codon Stop codon А. 438 В. 146 C. 620 D. 206 © 2013 John Wiley & Sons, Inc. All rights reserved.arrow_forwardExplain why inserting 5 bp of DNA at the –50 position of a eukaryotic gene decreases the rate of RNA polymerase II transcription initiation to a greater extent than inserting 10 bp at the same site.arrow_forward
- During the process of transcription, the polymerase must handle several distinct polynucleotide chains: the double-stranded DNA ahead of the polymerase, the single-stranded template DNA, the nontemplate DNA strand, and the freshly-synthesized mRNA. How does the polymerase keep each of these strands--as well as the incoming ribonucleotides needed for the polymerase reaction--separate?arrow_forwardWhat are the specific steps of eukaryotic transcription? Be sure in your discussion that you include the following terms: template strand, non-template strand, initiation, elongation, termination, promoter region, RNA polymerase, termination signal.arrow_forwardSeveral examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?arrow_forward
- Where will the promoter be relative to the start of transcription? Label the promoter. Where will the terminator be relative to the end of transcription? Label the terminator. What is the sequence of the mRNA produced from the template strand? Label the 5’ and 3’ ends.arrow_forwardThe human rhodopsin gene is 2675 nucleotides long from transcription start site to transcription stop site. The human rhodopsin protein is 348 amino acids. What is the length of the mature mRNA (starting at the start codon and ending at the stop codon) from which the rhodopsin protein is synthesized? Explain how you reached your answer, including information about introns, exons, and splicing.arrow_forwardOnce a primary RNA transcript is created from a DNA template, it must be modified in several ways before becoming messenger RNA (mRNA), ribosomal RNA (rRNA) or transfer RNA (tRNA). The following image shows RNA processing of one pre-mRNA into mRNA. Note that pre-RNA is processed in three ways: 1) a 5' methylguanylate cap (G cap) is added, 2) a poly-A tail is added, and 3) the spliceosome removes introns from the pre-mRNA transcript. Please redraw the following diagram and label the following on your diagram: DNA Promoter pre-mRNA (unprocessed) mRNA *5' methylguanylate cap *polyadenylation *Exon (may be more than one) *Intron (may be more than one) Transcription RNA processing AAAAAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license